Sium latifolium
speciesAt a glance
Occurrence records48 345
Data sources13
Biological traits47
DNA specimens38
eDNA detections26
Sources13 archives
Databases and archives Sium latifolium's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility48 345 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI26 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics38 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources47 traits
Chemical compositionLOTUS · NPASS10 compounds
Occurrence & distributionGBIF48 345 records
Environmental DNA2 datasets · 11 countries26 detections
DNA & barcodingBOLD · NCBI38 specimens
Genome at a glanceCCDB · GoaT2.4 Gbp
01Narrative
Sium latifolium, la Grande Berle ou Berle à larges feuilles, est une espèce de plantes à fleurs de la famille des Apiacées. C'est une plante herbacée vivace originaire d'Eurasie.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology15
Fruit length3 mm
Fruit length max3 mm
Fruit length min3 mm
Fruit width2 mm
Fruit width max2 mm
Fruit width min2 mm
Leaf mass248 mg
Leaf size31 623 mm²
⚠ sources differ — TRY: 31 623 mm² · LEDA: 18 804 mm² · GIFT: 14 522 mm²
Plant height1.16 m
⚠ sources differ — GIFT: 1.16 m · LEDA: 1.41 m · TRY: 1.51 m
Plant height generative0.9 m
Plant height max1.2 m
Plant height min0.6 m
Seed mass1.7 mg
⚠ sources differ — TRY: 1.7 mg · LEDA: 1.15 mg · GIFT: 1.46 mg
Seed mass max2.56 mg
Seed mass min1.41 mg
Life cycle & reproduction12
Deciduousnessevergreen
Dispersal typewater
Flowering endAug
Flowering startJul
Life formperennial or helophyte
Life spanperennial
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formcryptophyte
⚠ sources differ — LEDA: Hydrophyte · GIFT: hemicryptophyte
Reproduction asexualabsent
Seed number528
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment10
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max1 300 m
Elevation min100 m
Epiphyteterrestrial
Growth formherb
⚠ sources differ — GIFT: herb · TRY: Aquatic
Habitat GIFTlakes, meadows: wet, rivers, shores
Mycorrhiza typenon-mycorrhizal
Woodinessnon-woody
Physiology & chemistry7
Leaf C:N ratio14.0 g/g
Leaf c383 mg/g
Leaf dry-matter content (LDMC)157 mg/g
Leaf n27.37 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)22.27 mm²/mg
⚠ sources differ — TRY: 22.27 mm²/mg · LEDA: 47.23 mm²/mg · GIFT: 42.56 mm²/mg
Other traits1
Diaspore typegenerative dispersule
03Chemical composition10 compounds
Compounds documented for Sium latifolium across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Menthane monoterpenoids4
Pinane monoterpenoids2
Camphane monoterpenoids $ Fenchane monoterpenoids1
Daucane sesquiterpenoids1
Phenylethylamines1
Documented compounds10 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-alpha-Pinene | present | LOTUS | |
| (-)-beta-Pinene | present | LOTUS | |
| (-)-Camphene | present | LOTUS | |
| (R)-Limonene | present | LOTUS | |
| 1-Isopropyl-4-methylbenzene | present | LOTUS | |
| 7-Methyl-3-methylene-1,6-octadiene | present | LOTUS | |
| [(1R,3aR,4R,8aS)-8a-hydroxy-3a,6-dimethyl-3-oxo-1-propan-2-yl-2,4,7,8-tetrahydro-1H-azulen-4-yl] acetate | present | LOTUS | |
| D-Perillaldehyde | present | LOTUS | |
| O-Methyltyramine | present | NPASS | |
| Perillaldehyde | present | LOTUS |
05DNA & barcoding38 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sium latifolium has left across the world's sequence archives.
At a glance
DNA specimens38
Marker genes6
GenBank sequences10
eDNA detections26
Countries11
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATTAGGCTAAGGGCACGTCTGCCTGGGTGTCACGCATC …
Sium latifolium voucher NMW7107 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL4★rbcLa★ITS4★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Sium latifolium carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size2 371 650 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Sium latifolium2.37 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 20 n = 10
Ploidy2× diploid · measured
Chromosome records12–202n range20median20mode18records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2016×GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl · CCDB · nw-europe-fl +8
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1974b: Index of chromosome numbers of Slovakian flora Part 4. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 23: 1-23.
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3255
CCDB · poland — Skali?ska M., Pogan E., Jankun A. et al. 1968. Further studies in chromosome numbers of Polish Angiosperms. Seventh contribution. Acta Biol. Cracov. Ser. Bot. 11, 199-224.
CCDB · ipcn-api-dl — Vachova, M. 1974a. In Index to chromosome numbers of Slovakian flora. Part 4. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 23: 1–23.
CCDB · book-ipcn67-71 — SKALINSKA, M., E. POGAN, & A. JANKUN. 1968. Further studies in chromosome numbers of Polish Angiosperms, VII. Acta Biol. Cracov. Ser. Bot. 11: 199-224.
CCDB · book-ipcn67-71 — GADELLA, Th. W. J., & E. KLIPHUIS. 1966.' Chromosome numbers of flowering plants in the Netherlands II. Proc. Roy. Neth. Acad. Sci. Ser. C. 69: 541-556.
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian Flora. (Part 4). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 23: 1-23.
CCDB · eflora
CCDB · book-fedorov — Wulff 1938
CCDB · book-fedorov — Ehrenberg L. 1945
CCDB · book-fedorov — HAkansson 1953
CCDB · book-fedorov — Gadella, Kliphuis 196!)
CCDB · book-atlas-flowering-plants — Hakansson 1953 (V)
CCDB · CromoCat 2015 — Vachova, M.
Vachova, M. (1974a). In Index to chromosome numbers of Slovakian flora. Part 4. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 23: 1–23
CCDB · CromoCat 2015 — Vasileva, M. G.,T. V. Alexeeva, M. G. Pimenov & E. V. Kljuykov. (1991). IOPB Chromosome Data 3 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 17: 10-13.
2n 122×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Vassiljeva, M. G., T. V. Alexeeva, M. G. Pimenov & E. V. Kljuykov. 1991. IOPB chromosome data 3. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 17: 10–13.
CCDB · CromoCat 2015 — Vasileva, M. G.,T. V. Alexeeva, M. G. Pimenov & E. V. Kljuykov. (1991). IOPB Chromosome Data 3 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 17: 10-13.
n 66×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Vassiljeva, M. G., T. V. Alexeeva, M. G. Pimenov & E. V. Kljuykov. 1991. IOPB chromosome data 3. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 17: 10–13.
CCDB · ipcn-api-dl — Vasil'eva, M. G., J. V. Daushkevich, T. V. Alexeeva & M. G. Pimenov. 1993. IOPB chromosome data 5. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 20: 7–9.
CCDB · ipcn-api-dl — Alexeeva, T. V., M. G. Vasil'eva, J. V. Daushkevich & M. G. Pimenov. 1994. IOPB chromosome data 8. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 23: 11–12.
CCDB · CromoCat 2015 — Alexeeva, T. V., Vasileva, M. G., Daushkevich, J. V. & Pimenov, M. G. (1994). IOPB Chromosome Data 8 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 23 : 11-12.
CCDB · CromoCat 2015 — Vasileva, M. G., J. V. Daushkevich, T. V. Alexeeva & M. G. Pimenov. (1993). IOPB Chromosome Data 5 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 20: 7-9.
CCDB · CromoCat 2015 — Vasileva, M. G.,T. V. Alexeeva, M. G. Pimenov & E. V. Kljuykov. (1991). IOPB Chromosome Data 3 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 17: 10-13.
n 112×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Constance, L., T. i. Chuang & C. R. Bell. 1976. Chromosome numbers in Umbelliferae. V. Amer. J. Bot. 63(5): 608–625.
CCDB · CromoCat 2015 — Constance, L., Chuang, T. & Bell, C. R. (1976). Chromosome numbers in Umbelliferae. V. Amer. J. Bot. 63(5): 608-625.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · family-scale
PloiDB · family-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type48 345 records
Wild obs. + sensor43 649
Museum / vouchered4 336
Cultivated / captive16
Fossil1
Other343
Origin
Native1 200
Introduced22
Range
Area of Occupancy AOO73 828 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy55% within 1 km
≤100 m 10 763≤1 km 8 411≤10 km 14 895>10 km 585
34 654 georeferenced · 8 995 without coordinates
Open the mapobservation + sensor43 649
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy35% within 1 km
≤100 m 151≤1 km 899≤10 km 1 817>10 km 121
2 988 georeferenced · 1 348 without coordinates
Open the institutions mapphysical evidence4 336
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 2>10 km 13
15 georeferenced · 1 without coordinates
Open the mapnot free-living16
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions41 of 118 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 1 671 |
| Moscow State Universitylocation not on record | 309 |
| LDlocation not on record | 246 |
| South Kensington, GB | 137 |
| Adam Mickiewicz University in Poznańlocation not on record | 101 |
| MeiseBGlocation not on record | 99 |
| SLU Artdatabankenlocation not on record | 93 |
| Brussel, BE | 89 |
| Tartu, EE | 86 |
| Oskarshamn, SE | 84 |
| Uniwersytet Warszawskilocation not on record | 67 |
| BFLlocation not on record | 67 |
| BRNUlocation not on record | 59 |
| BMlocation not on record | 47 |
| Bern, CH | 46 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 42 |
| Tallinn, EE | 37 |
| Görlitz, DE | 28 |
| Uppsala, SE | 25 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 23 |
| DBF-NHMDlocation not on record | 15 |
| UGentlocation not on record | 15 |
| Universität Basel, Herbariumlocation not on record | 13 |
| BSBIlocation not on record | 12 |
| Berlin, DE | 11 |
| Natural History Museum Rotterdamlocation not on record | 11 |
| Cambridge University Herbariumlocation not on record | 11 |
| CJBGlocation not on record | 11 |
| Lausanne, CH | 10 |
| University of Leicesterlocation not on record | 10 |
| Turku, FI | 8 |
| NMWlocation not on record | 8 |
| Naturhistorische Gesellschaft Nürnberg e.V.location not on record | 8 |
| Wlocation not on record | 8 |
| Kew, GB | 7 |
| Dresden, DE | 7 |
| Department of Bacteriology, University of Wisconsinlocation not on record | 7 |
| Bourges, FR | 6 |
| Frankfurt am Main | 6 |
| University of Birminghamlocation not on record | 6 |
| Porrentruy, CH | 6 |
| Zürich, CH | 6 |
| BIO-UNIPIlocation not on record | 4 |
| Helsinki, FI | 4 |
| Bronx, US | 4 |
| University of Hulllocation not on record | 4 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 4 |
| Tilburg, NL | 4 |
| Urumqi, CN | 4 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 4 |
| Zürich, CH | 3 |
| National Museum Waleslocation not on record | 3 |
| Wardown House, Museum & Gallerylocation not on record | 3 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| Oulu, FI | 3 |
| Paris, FR | 3 |
| Porvoo, FI | 3 |
| GJOlocation not on record | 2 |
| Jyväskylä, FI | 2 |
| LfUlocation not on record | 2 |
| Samara National Research Universitylocation not on record | 2 |
| Olocation not on record | 2 |
| Provincia di Livornolocation not on record | 2 |
| Boumlocation not on record | 2 |
| MAlocation not on record | 2 |
| Hitchin Museumlocation not on record | 2 |
| Royal Botanic Garden Edinburghlocation not on record | 2 |
| Karlsruhe, DE | 2 |
| ER Hellerlocation not on record | 2 |
| Mlocation not on record | 2 |
| Durham, US | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| TUR-Alocation not on record | 2 |
| Stockholm, SE | 2 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 2 |
| Canberra, AU | 2 |
| Universidade Federal de Juiz de Foralocation not on record | 1 |
| PRClocation not on record | 1 |
| Fribourg, CH | 1 |
| PrivatHerblocation not on record | 1 |
| CGE|LTRlocation not on record | 1 |
| H-Drencklocation not on record | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| NoColllocation not on record | 1 |
| BM|NMWlocation not on record | 1 |
| Dorset County Museumlocation not on record | 1 |
| NMW|RNGlocation not on record | 1 |
| Wellington, NZ | 1 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 1 |
| Xiamen, CN | 1 |
| University of Newcastle upon Tynelocation not on record | 1 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 1 |
| Nijmegen, NL | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| BM|HLU|LTRlocation not on record | 1 |
| BIRM|BMlocation not on record | 1 |
| Québec, CA | 1 |
| València, ES | 1 |
| NWHlocation not on record | 1 |
| University of Readinglocation not on record | 1 |
| H-Adlerlocation not on record | 1 |
| Tromso University Museumlocation not on record | 1 |
| NMBU:MINAlocation not on record | 1 |
| Edinburgh, GB | 1 |
| Podgorica, ME | 1 |
| London Natural History Societylocation not on record | 1 |
| BM|HLUlocation not on record | 1 |
| Durham Universitylocation not on record | 1 |
| Trondheim, NO | 1 |
| BMHlocation not on record | 1 |
| South London Botanical Institutelocation not on record | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 1 |
| Oswego, US | 1 |
| Mount Annan, AU | 1 |
118 institutions · 3 693 of 4 336 vouchered records shown · 582 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA26 detections
Where the DNA of Sium latifolium was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found26
Studies independent surveys2
Countries11
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 26 detections have coordinates
Open the map11 countries0
Grown from seedin ditch under Salix, susceptible to grazing
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.7 °C 5.60–17.4
Seasonal swing summer↔winter19.6 °C
Max temp (day)16.8 °C 10.6–20.5
Min temp (night)9.30 °C 0.9–14.4
Precipitation60.9 mm/mo 24.4–80.8
Air humidity61.1 % 55.8–63.5
Moisture balance-30.6 mm/mo -74.1–13.4
Vapour deficit643 Pa 417–782
Wind speed4.10 m/s 2.60–5.50
Cloud cover43.7 % 39.1–51.4
CHELSA 1981–2010, ~9 km grid, at location & month of 22 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.