Sitophilus oryzae

A.Hustache, 1930 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Dryophthoridae/Sitophilus

At a glance

Occurrence records657

Data sources8

Biological traits0

DNA specimens552

eDNA detections548

Sources8 archives

Databases and archives Sitophilus oryzae's data was compiled from.

WikipediaWikimedia Foundation11 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility657 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI548 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics552 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF657 records

Environmental DNA2 datasets · 22 countries548 detections

DNA & barcodingBOLD552 specimens

Genome at a glanceGoaT · TreeOfSex≈771 Mbp

01Narrative

The rice weevil (Sitophilus oryzae) is a stored product pest which attacks seeds of several crops, including wheat, rice, and maize.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding552 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sitophilus oryzae has left across the world's sequence archives.

At a glance

DNA specimens552

BINs1

Marker genes4

eDNA detections548

Countries26

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P596 bp consensus532 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

9Cmostly conserved

10Tmostly conserved

18Gmostly conserved

231Amostly conserved

GGTACATCCTTAAGTTTGCTAATTCGGGCAGAACTAGGAAATCCTGGATCACTAATTGGAAATGACCAAATTTATAATACTATTGTCACA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.48%

Haplotypes33

BIN1

Most divergent pair4.2%

AsiaOtherAfricaEuropeOceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sitophilus granariussame genus14.1%Abagrotis dodisame order17.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-3P18S-5P

animal barcoderibosomal

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_030765 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND116S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Sitophilus oryzae carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈770 550 206 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Sitophilus oryzae0.77 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidy2× diploid · measured

Chromosome records12–222n range22median22mode12records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 229×GoaT · Tree of Sex Database · GoaT · Coleoptera Karyotype Database · TreeOfSex · invert

GoaT · Tree of Sex Database — ↗

GoaT · Coleoptera Karyotype Database — ↗

TreeOfSex · invert — Smith SG, Virkki N (1978) Animal Cytogenetics Vol. 3 Insecta 5 Coleoptera. Berlin: Gebruder Borntraeger. ↗

2n 123×GoaT · Tree of Sex Database · GoaT · Coleoptera Karyotype Database · TreeOfSex · invert

GoaT · Tree of Sex Database — ↗

GoaT · Coleoptera Karyotype Database — ↗

TreeOfSex · invert — Gunson MM (1943) The meiotic phase of Calandra oryzae. . Quarterly Journal of Microscopical Science 85: 107-117. ↗

2n 112×GoaT · Tree of Sex Database · GoaT · Coleoptera Karyotype Database

GoaT · Tree of Sex Database — ↗

GoaT · Coleoptera Karyotype Database — ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Coleoptera Karyotype Database

GoaT · Coleoptera Karyotype Database

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness98.5% BUSCO

08Occurrence & distribution

Record type657 records

Wild obs. + sensor315

Museum / vouchered325

Fossil17

Origin

Native4

Range

Area of Occupancy AOO1 580 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 132≤1 km 55≤10 km 26>10 km 22

235 georeferenced · 80 without coordinates

Open the mapobservation + sensor315

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy70% within 1 km

≤100 m 33≤1 km 36≤10 km 26>10 km 3

98 georeferenced · 227 without coordinates

Open the institutions mapphysical evidence325

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	36
The University of the West Indies, Trinidad and Tobagolocation not on record	27
Cape Town, ZA	14
Museo Entomologico de Leonlocation not on record	12
Edmonton, CA	12
Ugentlocation not on record	6
Chicago, US	3
Naturalis Biodiversity Centerlocation not on record	3
University of Oslo, Natural History Museumlocation not on record	3
FRIPlocation not on record	3
Winterthur, CH	2
Wuzhou, CN	1
KwaZulu-Natal Museumlocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1
Acharya N. G. Ranga Agricultural University, S. V. Agricultural college, tirupatilocation not on record	1
International Centre of Insect Physiology and Ecologylocation not on record	1
Essig Museum of Entomologylocation not on record	1

17 institutions · 127 of 325 vouchered records shown · 193 without an institution code

09Environmental DNA548 detections

Where the DNA of Sitophilus oryzae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found548

Studies independent surveys2

Countries22

Verifiable raw sequence linked5

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 548 detections have coordinates

Open the map22 countries0

greenhouseUrban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.0 °C 14.6–27.2

Seasonal swing summer↔winter12.4 °C

Max temp (day)30.0 °C 18.5–32.0

Min temp (night)19.3 °C 9.30–23.4

Precipitation100 mm/mo 29.7–188

Air humidity58.7 % 48.6–64.0

Moisture balance-17.8 mm/mo -95.2–63.6

Vapour deficit1,312 Pa 758–1,653

Wind speed2.60 m/s 1.20–4.10

Cloud cover32.9 % 20.9–45.9

CHELSA 1981–2010, ~9 km grid, at location & month of 300 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)