Sisyrinchium platense

I.M.Johnst. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Sisyrinchium

At a glance

Occurrence records293

Data sources10

Biological traits17

DNA specimens5

eDNA detections5

Sources10 archives

Databases and archives Sisyrinchium platense's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility293 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Occurrence & distributionGBIF293 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB · GoaT1.8 Gbp

01Narrative

Sisyrinchium platense is a species of flowering plant in the family Iridaceae. Native from the Pampas region of South America (Bolivia, Peru, northern Argentina, southern Brazil, Uruguay) they are found growing in fertile and moist soils.Laboratorio de Plantas Vasculares

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass0.16 mg

Seed mass max0.16 mg

Seed mass min0.16 mg

Life cycle & reproduction3

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max500 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTCampo Limpo

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sisyrinchium platense has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes3

GenBank sequences10

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSHQ607075.1 ↗663 bp

ACGT

GAACACCGAAAATCGGACCCAACGCGAACTTGTAACCCTAACGCCCCGCTCTCGGGCGGGGCAACCCCCCTGCGGAAGGACGGCCCTCGG …

Sisyrinchium platense isolate SP084 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK5★ITS5★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Sisyrinchium platense carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 809 300 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Sisyrinchium platense1.81 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 48 n = 24

Ploidy6× hexaploid · measured

Chromosome records48–482n range48median48mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 485×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · kew +1

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Kenton, A. Y., P. J. Rudall & A. R. Johnson. 1986. Genome size variation in Sisyrinchium L. (Iridaceae) and its relationship to phenotype and habitat. Bot. Gaz. 147: 342–354.

CCDB · kew — Kenton AY, Rudall PJ, Johnson AR. 1986. Genome size variation in Sisyrinchium L. (Iridaceae) and its relationship to phenotype and habitat. Botanical Gazette 147: 342-345.

CCDB · CromoCat 2015 — Kenton, A. Y., Rudall, P. J. & Johnson, A. R. (1986). Genome size variation in Sisyrinchium L. (Iridaceae) and its relationship to phenotype and habitat Bot. Gaz. 147: 342-354

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

hexaploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type293 records

Wild obs. + sensor213

Museum / vouchered77

Other3

Origin

Native21

Range

Area of Occupancy AOO776 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 94≤1 km 56≤10 km 12>10 km 3

165 georeferenced · 48 without coordinates

Open the mapobservation + sensor213

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy14% within 1 km

≤100 m 1≤10 km 6

7 georeferenced · 70 without coordinates

Open the institutions mapphysical evidence77

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Porto Alegre, BR	16
Universidade Federale do Rio Grande do Sullocation not on record	16
San Isidro, AR	10
Buenos Aires, AR	7
Córdoba, AR	7
Pelotas, BR	5
Lake Charles, US	3
San Jose State University, Museum of Birds and Mammalslocation not on record	2
Corrientes, AR	2
Bronx, US	1
BDBClocation not on record	1
Kew, GB	1
Minia, EG	1
University of Stellenboschlocation not on record	1
Cambridge, US	1

15 institutions · 74 of 77 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Sisyrinchium platense was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.9 °C 15.9–15.9

Seasonal swing summer↔winter15.7 °C

Max temp (day)21.8 °C

Min temp (night)11.5 °C

Precipitation66.4 mm/mo

Air humidity54.7 %

Moisture balance-49.9 mm/mo

Vapour deficit875 Pa

Wind speed3.80 m/s

Cloud cover27.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)