Sisyrinchium californicum

(Ker Gawl.) Dryand. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Sisyrinchium

At a glance

Occurrence records1 477

Data sources13

Biological traits14

DNA specimens13

eDNA detections11

Sources13 archives

Databases and archives Sisyrinchium californicum's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 477 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Chemical compositionNPASS46 compounds

Occurrence & distributionGBIF1 477 records

Environmental DNA1 datasets · 2 countries11 detections

DNA & barcodingBOLD · NCBI13 specimens

Genome at a glanceCCDB · GoaT685 Mbp

01Narrative

Sisyrinchium californicum is a species of flowering plant in the iris family known by the common names golden blue-eyed grass, yellow-eyed-grass, and golden-eyed-grass. It is native to the west coast of North America from British Columbia to central California, where it grows in moist habitat, often in coastal areas.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass1.03 mg

⚠ sources differ — TRY: 1.03 mg · GIFT: 1.18 mg

Seed mass max1.68 mg

Seed mass min0.96 mg

Life cycle & reproduction3

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition46 compounds

Compounds documented for Sisyrinchium californicum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavones7

Cinnamic acids and derivatives6

Simple phenolic acids6

Flavonols5

Flavanones3

Documented compounds46 total

Tissue Source Quantified only

Compound	Amount	Source
(1S,3R,4R,5R)-3-(3-(3,4-Dihydroxyphenyl)Prop-2-Enoyloxy)-1,4,5-Trihydroxycyclohexane-1-Carboxylic Acid	present	NPASS
(2R,3R,4S,5S,6R)-2-[(1R,2S)-3-hydroxy-1-(4-hydroxy-3-methoxyphenyl)-2-[4-[(E)-3-hydroxyprop-1-enyl]-2,6-dimethoxyphenoxy]propoxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	NPASS
(2S)-5,7,3',4'-Tetrahydroxyflavanone 6-C-glucoside	present	NPASS
(Z)-3-phenyl-2-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyprop-2-enoic acid	present	NPASS
3,5-Dihydroxybenzoic acid	present	NPASS
4-Hydroxybenzoic acid	present	NPASS
Aesculetin	present	NPASS
AKGDIVKDYFDRLS-VJCFOKSDSA-N	present	NPASS
Aspalathin	present	NPASS
Catechin	present	NPASS

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sisyrinchium californicum has left across the world's sequence archives.

At a glance

DNA specimens13

Marker genes5

GenBank sequences10

eDNA detections11

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG216745.1 ↗338 bpCanada · 1938

ACGT

CCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGGCCATCCGGCCGAGGGCACGCCTGCCTGGGCGTCACGCCTCGTATCGCTC …

Sisyrinchium californicum voucher CCDB-18296-C01 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL4★rbcLa★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Sisyrinchium californicum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size684 600 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Sisyrinchium californicum0.68 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidy4× tetraploid · measured

Chromosome records32–362n range32median32mode10records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 326×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Kenton, A. Y., P. J. Rudall & A. R. Johnson. 1986. Genome size variation in Sisyrinchium L. (Iridaceae) and its relationship to phenotype and habitat. Bot. Gaz. 147: 342–354.

CCDB · kew — Kenton AY, Rudall PJ, Johnson AR. 1986. Genome size variation in Sisyrinchium L. (Iridaceae) and its relationship to phenotype and habitat. Botanical Gazette 147: 342-345.

2n 342×CCDB · brit-fl · CCDB · book-atlas-flowering-plants

CCDB · brit-fl — Maude, P.F. New Phytol. 38: 1-31 (1939)

CCDB · book-atlas-flowering-plants — Maude 1940

2n 362×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants — Bowden 1945a

CCDB · book-atlas-flowering-plants

n 172×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — Henderson, D. M., J. Jenson & J. LYON. 1975. In IOPB chromosome number reports XLVIII. Taxon 24: 367–372.

CCDB · book-ipcn75-78 — Henderson et al. 1975

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

tetraploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 477 records

Wild obs. + sensor1 373

Museum / vouchered103

Cultivated / captive1

Range

Area of Occupancy AOO1 848 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy46% within 1 km

≤100 m 483≤1 km 59≤10 km 619>10 km 29

1 190 georeferenced · 183 without coordinates

Open the mapobservation + sensor1 373

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy61% within 1 km

≤100 m 13≤1 km 24≤10 km 23>10 km 1

61 georeferenced · 42 without coordinates

Open the institutions mapphysical evidence103

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WTUlocation not on record	25
Arcata, US	15
Angwin, US	12
San Diego, US	8
Madison, US	5
Nijmegen, NL	4
Vancouver, CA	3
La Paz, MX	3
US	3
Oskarshamn, SE	3
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	2
Wlocation not on record	2
Bronx, US	1
Bend, US	1
San Jose, US	1
Santa Barbara, US	1
University of British Columbia, Herbariumlocation not on record	1
Davis, US	1
Severin-McDaniel Insect Collectionlocation not on record	1
Provo, US	1
Tilburg, NL	1
Porto Alegre, BR	1
San Luis Obispo, US	1
San Isidro, AR	1
Montréal, CA	1

25 institutions · 98 of 103 vouchered records shown · 4 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA11 detections

Where the DNA of Sisyrinchium californicum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map2 countries0

Seepage area behind rocky headland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.5 °C 12.5–12.5

Seasonal swing summer↔winter17.6 °C

Max temp (day)16.2 °C 14.4–18.0

Min temp (night)9.80 °C 8.60–11.0

Precipitation106 mm/mo 84.9–127

Air humidity61.8 % 58.2–65.4

Moisture balance-15.8 mm/mo -33.9–2.20

Vapour deficit612 Pa 514–709

Wind speed5.20 m/s 4.80–5.70

Cloud cover37.8 % 36.9–38.7

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Sisyrinchium californicum

At a glance

Sources13 archives

Size & morphology3

Life cycle & reproduction3

Diet & foraging1

Habitat & environment6

Physiology & chemistry1

Compound class profile5 classes

Documented compounds46 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type1 477 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions20 of 25 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 477 records