Sisyrinchium angustifolium
Mill. · speciesAt a glance
Occurrence records7 093
Data sources10
Biological traits99
DNA specimens26
eDNA detections16
Sources10 archives
Databases and archives Sisyrinchium angustifolium's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility7 093 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics26 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources99 traits
Occurrence & distributionGBIF7 093 records
Environmental DNA1 datasets · 2 countries16 detections
DNA & barcodingBOLD · NCBI26 specimens
Genome at a glanceCCDB2n = 96
01Narrative
La Bermudienne à feuilles étroites est une espèce de plante de la famille des Iridaceae.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTUSDATRY
Size & morphology6
Plant height0.61 m
Plant height max0.35 m
Plant height min0.25 m
Seed mass0.6 mg
Seed mass max0.6 mg
Seed mass min0.6 mg
Life cycle & reproduction27
After harvest regrowth rateSlow
Bloom periodMid Spring
Coppice potentialNo
Flower colourblue
Flower conspicuousYes
Flowering endJun
Flowering startMay
Fruit seed period beginSpring
Fruit seed period endSummer
Growth rate USDAModerate
Life formperennial
Life spanperennial
Lifespan categoryShort
Propagated by bare rootYes
Propagated by bulbYes
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formhemicryptophyte
Resprout abilityNo
Seed spread rateSlow
Seedling vigorLow
Vegetative spread rateNone
Diet & foraging1
Parasiteindependent
Habitat & environment25
Active growth periodSpring and Summer
Adapted to coarse textured soilsNo
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatesubtropical
Climberself-supporting
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureFine
Fruit colourblack
Growth formherb
Growth form USDABunch
Habitat GIFTopen, roadside
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Root depth min4 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry19
Anaerobic toleranceLow
C:N ratioHigh
Caco3 toleranceLow
Cold stratification requiredNo
Drought toleranceLow
Fertility requirementLow
Fire resistantNo
Fire toleranceHigh
Frost free days min180 days
Moisture useMedium
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max60 in
Precipitation min32 in
Salinity toleranceNone
Shade toleranceMedium
Soil pH max7 pH
Soil pH min5 pH
Temperature min-3 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalLow
Palatable graze animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound757 000 per lb
ToxicityNone
Veneer productNo
Other traits6
Fall conspicuousNo
Fruit seed abundanceLow
Fruit seed conspicuousNo
Fruit seed persistenceNo
Planting density max2 700 per acre
Planting density min1 700 per acre
05DNA & barcoding26 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sisyrinchium angustifolium has left across the world's sequence archives.
At a glance
DNA specimens26
Marker genes6
GenBank sequences10
eDNA detections16
Countries2
The DNA barcodea real sequence read deposited for this species
AAAGCAGGTGTTGGATTTAAAGCTGGTGTTAAAGATTACAGATTGACTTATTATACTCCTGATTACGAAACCAAAGATACTGATATCTTG …
Sisyrinchium angustifolium ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL7★rbcLa★ITS★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB
The complete instruction manual Sisyrinchium angustifolium carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 96 n = 48
Ploidypolyploid inferred
Chromosome records96–962n range96median96mode4records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 964×CCDB · ipcn-api-dl · CCDB · eflora · CCDB · book-fedorov +1
CCDB · ipcn-api-dl — Murin, A. & J. Majovsky. 1976. In IOPB chromosome number reports LIII. Taxon 25: 483–500.
CCDB · eflora
CCDB · book-fedorov — Bowden 1945a
CCDB · book-atlas-flowering-plants
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type7 093 records
Wild obs. + sensor4 084
Museum / vouchered3 005
Cultivated / captive2
Fossil1
Other1
Origin
Native6
Introduced8
Range
Area of Occupancy AOO21 672 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy82% within 1 km
≤100 m 2 031≤1 km 372≤10 km 263>10 km 260
2 926 georeferenced · 1 158 without coordinates
Open the mapobservation + sensor4 084
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy38% within 1 km
≤100 m 227≤1 km 401≤10 km 900>10 km 145
1 673 georeferenced · 1 332 without coordinates
Open the institutions mapphysical evidence3 005
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 2 records without
Open the mapnot free-living2
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions147 of 226 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Chongqing Museumlocation not on record | 315 |
| Philadelphia, US | 247 |
| Tampa, US | 155 |
| University of Stellenboschlocation not on record | 84 |
| Québec, CA | 80 |
| Williamsburg, US | 75 |
| College Park, US | 69 |
| Bangkok, TH | 67 |
| Bronx, US | 66 |
| Saint Louis, US | 64 |
| Acadia Universitylocation not on record | 60 |
| Madison, US | 57 |
| Wuzhou, CN | 57 |
| Ann Arbor, US | 49 |
| Burlington, US | 48 |
| Durango, MX | 47 |
| New Haven, US | 44 |
| Miami, US | 43 |
| Chapel Hill, US | 42 |
| Jackson, US | 41 |
| Fort Worth, US | 40 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 40 |
| Allentown, US | 30 |
| BAYLUlocation not on record | 27 |
| National Institute of Biological Resourceslocation not on record | 26 |
| Tacoma, US | 26 |
| Bloomington, US | 26 |
| Austin, US | 25 |
| University of New Hampshirelocation not on record | 23 |
| Knoxville, US | 23 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 23 |
| Kochi, JP | 23 |
| Montréal, CA | 22 |
| Lubbock, US | 22 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 21 |
| Mississippi State, US | 19 |
| NSMKlocation not on record | 18 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 18 |
| Montréal, CA | 17 |
| Université Lavallocation not on record | 17 |
| Chapingo, MX | 16 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 16 |
| Fayetteville, US | 16 |
| Tall Timbers Research Stationlocation not on record | 16 |
| Little Rock, US | 15 |
| GB | 15 |
| Norfolk, US | 15 |
| Pocatello, US | 14 |
| Tuscaloosa, US | 14 |
| Valdosta State Universitylocation not on record | 14 |
| EL PASO, US | 13 |
| US | 13 |
| Columbia, US | 12 |
| Philadelphia, US | 12 |
| Moscow, US | 12 |
| AUAlocation not on record | 12 |
| GAlocation not on record | 11 |
| Mount Berry, US | 11 |
| International Salmonella Centre (W.H.O.)location not on record | 11 |
| Pittsburg, US | 11 |
| Millersville, US | 10 |
| Odawara, JP | 10 |
| St. Paul, US | 10 |
| San Sebastián, ES | 10 |
| Jena Microbial Resource Collectionlocation not on record | 8 |
| Juriquilla, MX | 8 |
| Johnson City, US | 8 |
| Portland, US | 8 |
| WTUlocation not on record | 7 |
| Guasave, MX | 7 |
| Fairfax, US | 7 |
| Denton, US | 7 |
| Sagamihara, JP | 7 |
| Pullman, US | 6 |
| Provo, US | 6 |
| University of Alberta Museumslocation not on record | 6 |
| Springfield, US | 6 |
| Victoria, CA | 6 |
| San Angelo, US | 6 |
| University of Tennessee at Chattanoogalocation not on record | 6 |
| Mexico City, MX | 5 |
| Kirksville, US | 5 |
| Vancouver, CA | 5 |
| Morgantown, US | 5 |
| Adam Mickiewicz University in Poznańlocation not on record | 5 |
| Mexico City, MX | 5 |
| Clemson, US | 5 |
| MeiseBGlocation not on record | 5 |
| Asheville, US | 4 |
| Ciudad de México, MX | 4 |
| University of North Carolina at Pembrokelocation not on record | 4 |
| Dekalb, US | 4 |
| Auckland, NZ | 4 |
| Riverside, US | 4 |
| Washington, US | 4 |
| Paris, FR | 4 |
| Richmond, US | 4 |
| Western Carolina Universitylocation not on record | 4 |
| Cheney, US | 4 |
| Edmonton, CA | 4 |
| Logan, US | 4 |
| Bend, US | 4 |
| Lord Fairfax Community Collegelocation not on record | 4 |
| Cape Town, ZA | 4 |
| Toronto, CA | 3 |
| Smithsonian Institutionlocation not on record | 3 |
| Flagstaff, US | 3 |
| Davenport, US | 3 |
| Phoenix, US | 3 |
| Vitoria, ES | 3 |
| Boise, US | 3 |
| Denver, US | 3 |
| Mexico City, MX | 3 |
| València, ES | 3 |
| BRNUlocation not on record | 3 |
| University of Guelph, OAC Herbariumlocation not on record | 3 |
| Saint John, CA | 3 |
| Museo Achille Folettolocation not on record | 3 |
| Stephenville, US | 3 |
| Salamanca, ES | 3 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 3 |
| McWane Science Centerlocation not on record | 3 |
| Walla Walla, US | 3 |
| Conway, US | 2 |
| Staten Island, US | 2 |
| Chadron, US | 2 |
| SLU Artdatabankenlocation not on record | 2 |
| Oskarshamn, SE | 2 |
| PRClocation not on record | 2 |
| New Brunswick, US | 2 |
| Northridge, US | 2 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 2 |
| Conway, US | 2 |
| Parthenon Tama History Museumlocation not on record | 2 |
| Beijing, CN | 2 |
| Whitewater, US | 2 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 2 |
| ENHMlocation not on record | 2 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 2 |
| IWEP FEB RASlocation not on record | 2 |
| Taipei, TW | 2 |
| KNAMlocation not on record | 2 |
| Oswego, US | 2 |
| Green Bay, US | 2 |
| Fredericksburg, US | 2 |
| Henderson State Universitylocation not on record | 2 |
| Giardini Botanici Hanburylocation not on record | 2 |
| Portland, US | 2 |
| China Agricultural Universitylocation not on record | 2 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 2 |
| Canadian Department of Agriculturelocation not on record | 2 |
| Nagatoro-machi, Chichibu-gun, JP | 2 |
| Madrid, ES | 2 |
| Chicago, US | 2 |
| Texas A&M Universitylocation not on record | 2 |
| DOI/NPS, Greenbelt Parklocation not on record | 2 |
| Chicago, US | 1 |
| San Luis Obispo, US | 1 |
| BClocation not on record | 1 |
| South Kensington, GB | 1 |
| Durham, US | 1 |
| Long Beach, US | 1 |
| ASUlocation not on record | 1 |
| Missoula, US | 1 |
| Bourges, FR | 1 |
| Wlocation not on record | 1 |
| University of South Carolina Salkehatchielocation not on record | 1 |
| Russellville, US | 1 |
| Universität Göttingenlocation not on record | 1 |
| Entomological Society of Latvialocation not on record | 1 |
| CASlocation not on record | 1 |
| Kew, GB | 1 |
| USP-IBlocation not on record | 1 |
| LINUlocation not on record | 1 |
| Cambridge, US | 1 |
| Lincoln, US | 1 |
| University of Winnipeglocation not on record | 1 |
| Cape Town, ZA | 1 |
| MAlocation not on record | 1 |
| US | 1 |
| Chicago, US | 1 |
| West Virginia Wesleyan Collegelocation not on record | 1 |
| Trois-Rivières, CA | 1 |
| Turlock, US | 1 |
| Mohonk Preservelocation not on record | 1 |
| Jaén, ES | 1 |
| Arequipa, PE | 1 |
| Mount Pleasant, US | 1 |
| Herbario Selva Central Oxapampa - estación biológica del Jardín Botánico de Missourilocation not on record | 1 |
| Due West, US | 1 |
| Tlalnepantla, MX | 1 |
| Minia, EG | 1 |
| University of Lethbridgelocation not on record | 1 |
| Macomb, US | 1 |
| Maryland Department of Natural Resourceslocation not on record | 1 |
| Bozeman, US | 1 |
| SJNAlocation not on record | 1 |
| Coimbra, PT | 1 |
| Elikins, US | 1 |
| Oulu, FI | 1 |
| Tempe, US | 1 |
| GNWPlocation not on record | 1 |
| Spearfish, US | 1 |
| University of Southern Mississippilocation not on record | 1 |
| San Diego, US | 1 |
| Museum of the Rockieslocation not on record | 1 |
| Uppsala, SE | 1 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 1 |
| Zürich, CH | 1 |
| Fukushima Universitylocation not on record | 1 |
| Ashland, US | 1 |
| Keene State Universitylocation not on record | 1 |
| WINlocation not on record | 1 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 1 |
| Hiratsuka City Museumlocation not on record | 1 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 1 |
| Sendai, JP | 1 |
| Edinburgh, GB | 1 |
| Mérida, MX | 1 |
| Moscow State Universitylocation not on record | 1 |
| Davis, US | 1 |
| Culiacán, MX | 1 |
| Emporia, US | 1 |
| Corvallis, US | 1 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
226 institutions · 2 911 of 3 005 vouchered records shown · 92 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA16 detections
Where the DNA of Sisyrinchium angustifolium was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found16
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 16 detections have coordinates
Open the map2 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.8 °C -4.40–18.8
Seasonal swing summer↔winter28.0 °C
Max temp (day)18.6 °C -1.10–22.7
Min temp (night)9.10 °C -6.50–16.1
Precipitation91.1 mm/mo 54.0–129
Air humidity59.5 % 55.7–65.1
Moisture balance-1.80 mm/mo -55.7–11.6
Vapour deficit704 Pa 269–882
Wind speed3.10 m/s 2.80–5.60
Cloud cover43.9 % 39.8–57.6
CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.