Sisymbrium volgense

M.Bieb. ex E.Fourn. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Brassicales/Brassicaceae/Sisymbrium

At a glance

Occurrence records1 793

Data sources10

Biological traits26

DNA specimens3

eDNA detections3

Sources10 archives

Databases and archives Sisymbrium volgense's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 793 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources26 traits

Occurrence & distributionGBIF1 793 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 14

01Narrative

Sisymbrium volgense is a species of flowering plant belonging to the family Brassicaceae. Its native range is Southwestern European Russia to Caucasus. Synonym: Sisymbrium wolgense M. Bieb. ex Fourn. (orthographical variant)

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology6

Plant height0.35 m

⚠ sources differ — GIFT: 0.35 m · LEDA: 0.35 m · TRY: 0.575 m

Plant height generative0.525 m

Plant height max0.75 m

Plant height min0.3 m

Seed length1.52 mm

Seed mass0.182 mg

Life cycle & reproduction10

Deciduousnessaestival

⚠ sources differ — TRY: aestival · GIFT: deciduous

Dispersal typeself

Flowering endAug

Flowering startMay

Life formperennial

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formhemicryptophyte

Self fertilizationpresent

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTroadsides

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Diaspore typeseed

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sisymbrium volgense has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences10

eDNA detections3

The DNA barcodea real sequence read deposited for this species

ITSMW271753.1 ↗630 bp

ACGT

GCGGAAGGATCATTGTTGATGCCTAAACCAAAACGACCCGAGAACGCTCGATCATCACTCTTGGCGGGACGGTTTTTAGCTGATCCTGTT …

Sisymbrium volgense isolate G38 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Sisymbrium volgense carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome records14–142n range14median14mode14records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1414×CCDB · slov-fl · CCDB · nw-europe-fl · CCDB · ipcn-api-dl +4

CCDB · slov-fl — Májovský J. et al., 1974b: Index of chromosome numbers of Slovakian flora Part 4. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 23: 1-23.

CCDB · slov-fl — Feráková V. & Schwarzová T., 1974: K problematike cytotaxonomického výskumu synantropných druhov v ČSSR. - Acta Inst. Bot. Acad. Sci. Slov. 1: 41-50.

CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2266

CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Dvorak, F., F. Grull, I. Ruzicka & B. Dadakova. 1979. In IOPB chromosome number ! reports LXIV. Taxon 28: 391–392.

CCDB · ipcn-api-dl — Ferakova, V. 1974. In Index of chromosome numbers of Slovakian flora. Part 4. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 23: 1–23.

CCDB · book-ipcn75-78 — Ferakova 1974

CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian Flora. (Part 4). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 23: 1-23.

CCDB · book-fedorov — Manton 1932

CCDB · brass — Semerenko

CCDB · brass — Mjovsky et al.

CCDB · brass — Dvork et al.

CCDB · brass — Dvork & Dadkov

CCDB · brass — Manton

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 793 records

Wild obs. + sensor1 135

Museum / vouchered658

Origin

Introduced55

Range

Area of Occupancy AOO3 720 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 524≤1 km 127≤10 km 250>10 km 30

931 georeferenced · 204 without coordinates

Open the mapobservation + sensor1 135

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 34≤1 km 83≤10 km 117>10 km 105

339 georeferenced · 319 without coordinates

Open the institutions mapphysical evidence658

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 41 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	150
Helsinki, FI	100
LDlocation not on record	84
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	43
Tartu, EE	42
Oskarshamn, SE	27
Oulu, FI	24
Olocation not on record	21
Görlitz, DE	18
SLU Artdatabankenlocation not on record	18
TUR-Alocation not on record	17
Bergen, NO	16
Turku, FI	12
MeiseBGlocation not on record	10
Brussel, BE	7
Trondheim, NO	5
Tula State Lev Tolstoy Pedagogical Universitylocation not on record	5
Jyväskylä, FI	5
Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record	4
Institute of the biological problems of the North FEB RASlocation not on record	4
BRNUlocation not on record	4
Berlin, DE	3
Uppsala, SE	3
TROMlocation not on record	3
San Jose State University, Museum of Birds and Mammalslocation not on record	2
Frankfurt am Main	2
Uniwersytet Śląski w Katowicachlocation not on record	2
Institut und Museum fuer Geologie und Palaeontologielocation not on record	2
Mlocation not on record	2
Adam Mickiewicz University in Poznańlocation not on record	2
Porvoo, FI	1
DBF-NHMDlocation not on record	1
Wlocation not on record	1
Tallinn, EE	1
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	1
Provincia di Livornolocation not on record	1
Kew, GB	1
The Tula Region State Institution of Culture "Tula Museum Association"location not on record	1
Zürich, CH	1
Kuopio, FI	1
PRClocation not on record	1

41 institutions · 648 of 658 vouchered records shown · 10 without an institution code

09Environmental DNA3 detections

Where the DNA of Sisymbrium volgense was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Sisymbrium volgense

At a glance

Sources10 archives

Size & morphology6

Life cycle & reproduction10

Diet & foraging1

Habitat & environment7

Physiology & chemistry1

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 793 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions18 of 41 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 793 records