Sisymbrium orientale
speciesAt a glance
Occurrence records23 063
Data sources12
Biological traits57
DNA specimens33
eDNA detections18
Sources12 archives
Databases and archives Sisymbrium orientale's data was compiled from.
WikipediaWikimedia Foundation9 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility23 063 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics33 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources57 traits
Occurrence & distributionGBIF23 063 records
Environmental DNA1 datasets · 7 countries18 detections
DNA & barcodingBOLD · NCBI33 specimens
Genome at a glanceCCDB · GoaT528 Mbp
01Narrative
Sisymbrium orientale is a species of flowering plant in the family Brassicaceae known by the common names Indian hedgemustard and eastern rocket. It is native to Europe, Asia, and North Africa, and it can be found throughout much of the temperate world as an introduced species and in some areas a common roadside weed. It is an annual herb producing a hairy, branching stem up to about 30 centimeters tall. The basal leaves are divided into deep lobes or toothed leaflets. Leaves higher on the stem have lance-shaped blades with small separate lobes near the base. The top of the stem is occupied by a raceme of flowers with light yellow petals each measuring up to a centimeter long. The fruit is a silique which can be up to 10 centimeters long.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology19
Fruit length70 mm
⚠ sources differ — AusTraits: 70 mm · GIFT: 80 mm
Fruit length max100 mm
Fruit length min40 mm
Fruit width1.25 mm
⚠ sources differ — AusTraits: 1.25 mm · GIFT: 1 mm
Leaf length105 mm
Leaf length max110 mm
Leaf mass145 mg
Leaf size167 mm²
⚠ sources differ — AusTraits: 167 mm² · LEDA: 3 510 mm² · GIFT: 3 510 mm²
Leaf width50 mm
Leaf width max50 mm
Leaf width min50 mm
Plant height0.496 m
⚠ sources differ — GIFT: 0.496 m · AusTraits: 0.9 m · LEDA: 0.35 m · TRY: 0.5 m
Plant height generative0.5 m
Plant height max1 m
Plant height min0.1 m
Seed length1 mm
Seed mass0.251 mg
⚠ sources differ — TRY: 0.251 mg · LEDA: 0.184 mg · GIFT: 0.228 mg
Seed mass max0.48 mg
Seed mass min0.17 mg
Life cycle & reproduction16
Deciduousnessalways persistent green
⚠ sources differ — TRY: always persistent green · GIFT: deciduous
Dispersal typeself
⚠ sources differ — LEDA: boleochor · GIFT: unspecialized
Flower colouryellow
Flower length max9 mm
Flower length min5 mm
Flowering endJul
Flowering startApr
Life formannual
Life spanannual/biennial
⚠ sources differ — TRY: annual/biennial · AusTraits: annual biennial · GIFT: annual
Lifespan years1.5 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Reproduction asexualabsent
Resprouting capacityfire_killed
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max3 500 m
Elevation min0 m
Epiphyteterrestrial
Fruit typesilique
⚠ sources differ — AusTraits: silique · GIFT: capsule
Growth formherb
Habitat GIFTLowland
Leaf compoundnesssimple
Leaf formelliptic
Leaf shapelanceolate
Mycorrhiza typenon-mycorrhizal
Woodinessnon-woody
Physiology & chemistry4
Leaf dry-matter content (LDMC)125 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Specific leaf area (SLA)17.5 mm²/mg
⚠ sources differ — TRY: 17.5 mm²/mg · LEDA: 21.55 mm²/mg · GIFT: 22.33 mm²/mg
Other traits2
Diaspore typeseed
Leaf arrangementrosette
05DNA & barcoding33 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sisymbrium orientale has left across the world's sequence archives.
At a glance
DNA specimens33
Marker genes5
GenBank sequences10
eDNA detections18
Countries8
The DNA barcodea real sequence read deposited for this species
ATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGTGTCACAAA …
Sisymbrium orientale isolate Peru170470 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL4★rbcLa★ITS3★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Sisymbrium orientale carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size528 120 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Sisymbrium orientale0.53 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 14 n = 7
Ploidy2× diploid · measured
Chromosome records14–142n range14median14mode67records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1467×GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl · CCDB · slov-fl +9
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — MICELI P., SPAZZAFUMO A., GARBARI F. - 1978. Numeri cromosomici per la flora italiana:423-433.. Inform. Bot. Ital. , 10(1): 110-119.
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · slov-fl — Dvořák F. & Dadáková B., 1984: Chromosome counts and chromosome morphology of some selected species. - Folia Geobot. Phytotax. 19/1: 41-70.
CCDB · slov-fl — Dvořák F. & Dadáková B., 1975c: [Report], pp. 508-509. - In: Löve Á. (ed.), IOPB Chromosome number report XLIX, Taxon 24 /4.
CCDB · slov-fl — Dvořák F. & Dadáková B., 1975b: Study of chromosomes of angiosperms 2. - Scripta Fac. Sci. Nat. Univ. J. E. Purkynianae Brun. 1, 5: 31-50.
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2268
CCDB · fl-europaea — Baez-Mayor, 1934
CCDB · ipcn-api-dl — Polatschek, A. 1983. Chromosomenzahlen und hinweise auf systematik und verbreitung van Brassicaceae-Arten aus Europa, Nordafrika, Asien und Australien. Phyton (Horn). 23: 127–139.
CCDB · ipcn-api-dl — Carrique, M. C. & A. J. Martínez. 1984. Números de cromosómas de Cruciferae 1. Parodiana 3: 113–128.
CCDB · ipcn-api-dl — Dobea, C., B. Hahn & W. Morawetz. 1997. Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5–43.
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Mĕsíček, J. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.
CCDB · ipcn-api-dl — Ančev, M. E. 1981. In Chromosome number reports LXXIII. Taxon 30:855.
CCDB · ipcn-api-dl — Dvorak, F. & B. Dadakova. 1975. Study of chromosomes of Angiosperms 2. Scripta Fac. Sci. Nat. Univ. Purkyn. Brun. 1.5: 31–50.
CCDB · ipcn-api-dl — Dvorak, F., F. Grull, K. Sutory & B. Dadakova. 1981. In Chromosome number reports LXXIII. Taxon 30:844.
CCDB · ipcn-api-dl — Murin, A. 1978. In Index of chromosome numbers of Slovakian flora. Part 6. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 26: 1–42.
CCDB · ipcn-api-dl — Ancev, M. E. 1978b. In IOPB chromosome number reports LXII. Taxon 27: 519–535.
CCDB · ipcn-api-dl — Dvorak, F. & B. Dadakova. 1975a. In IOPB chromosome number reports XLIX. Taxon 24: 501–516.
CCDB · ipcn-api-dl — Kliphuis, E. & Y. I. Barkoudah. 1977. Chromosome numbers in some Syrian angiosperms. Acta Bot. Neerl. 26: 239–249.
CCDB · ipcn-api-dl — Runemark, H. 2000. Mediterranean chromosome number reports 10 (1110--1188). Fl. Medit. 10: 386–402.
CCDB · ipcn-api-dl — Johnston. 2005. Evolution of genome size in Brassicaceae. Ann. Bot. (Oxford) 95: 229–235.
CCDB · ipcn-api-dl — Gregor, T. & R. Hand. 2006. Chromosomenzahlen von Farn- und Samenpflanzen aus Deutschland 1. Kochia 1: 135–140.
CCDB · book-ipcn75-78 — Miceli et al. 1978
CCDB · book-ipcn75-78 — Kliphuis & Barkoudah 1977
CCDB · book-ipcn75-78 — Dvorak & Dadakova 1975a
CCDB · book-ipcn75-78 — Murin 1978
CCDB · book-ipcn75-78 — Ancev 1978
CCDB · eflora
CCDB · book-fedorov — Baez-Major 1934
CCDB · book-fedorov — T. 1938)
CCDB · book-fedorov — Jaretzky 1932
CCDB · book-fedorov — Diers 1961
CCDB · brass — Carrique & Martnez
CCDB · brass — Dobes et al.
CCDB · brass — Ancev
CCDB · brass — Dvork & Dadkov
CCDB · brass — Mjovsky et al.
CCDB · brass — Dvork et al.
+23 more references
2n 02×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Carrique, M. C. & Martínez, A. J. (1984). Números de cromosomas de Cruciferae 1. Parodiana 3: 113-128.
CCDB · CromoCat 2015 — Jeelani, R. M., Kumari, S. & Gupta, R. C. (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1788-1789
2n 71×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Kaur, D. & Singhal, V. K (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:894-895
n 711×CCDB · iapt · CCDB · book-ipcn65 · CCDB · ipcn-api-dl +3
CCDB · iapt — IAPT/IOPB Chromosome Data 13
CCDB · book-ipcn65 — Raj 1965
CCDB · ipcn-api-dl — Al-Shehbaz, I. A. & M. M. Al-Omar. 1982. In IOPB chromosome number reports LXXVI. Taxon 31: 587–589.
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.
CCDB · book-ipcn66 — Rollins1966
CCDB · brass — Raj
CCDB · brass — Al-Shehbaz & Al-Omar
CCDB · brass — Jaretzky
CCDB · brass — Rollins
CCDB · CromoCat 2015 — Al-Shehbaz, I. A. & Al-Omar, M. M. (1982). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXVII]. Taxon 31(3): 587-589.
CCDB · CromoCat 2015 — Strid, A. & R. Franzén. (1981). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXIII]. Taxon 30(4): 829-842.
n 143×CCDB · iapt · CCDB · CromoCat 2015
CCDB · iapt — IAPT/IOPB Chromosome Data 12
CCDB · CromoCat 2015 — Carrique, M. C. & Martínez, A. J. (1984). Números de cromosomas de Cruciferae 1. Parodiana 3: 113-128.
CCDB · CromoCat 2015 — Jeelani, R. M., Kumari, S. & Gupta, R. C. (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1788-1789
n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Kaur, D. & Singhal, V. K (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:894-895
n 181×CCDB · iapt
CCDB · iapt — IAPT/IOPB Chromosome Data 30
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type23 063 records
Wild obs. + sensor17 935
Museum / vouchered5 037
Cultivated / captive2
Other89
Origin
Native999
Introduced4 061
Range
Area of Occupancy AOO42 880 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy44% within 1 km
≤100 m 3 916≤1 km 3 275≤10 km 9 282>10 km 54
16 527 georeferenced · 1 408 without coordinates
Open the mapobservation + sensor17 935
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy53% within 1 km
≤100 m 360≤1 km 794≤10 km 831>10 km 175
2 160 georeferenced · 2 877 without coordinates
Open the institutions mapphysical evidence5 037
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 2 records without
Open the mapnot free-living2
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions132 of 228 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Berlin, DE | 633 |
| San Diego, US | 246 |
| Adelaide, AU | 245 |
| Riverside, US | 192 |
| Claremont, US | 177 |
| Mount Annan, AU | 142 |
| LDlocation not on record | 136 |
| Santa Barbara, US | 130 |
| MeiseBGlocation not on record | 112 |
| MAlocation not on record | 112 |
| Museo Entomologico de Leonlocation not on record | 111 |
| València, ES | 108 |
| Canberra, AU | 106 |
| Helsinki, FI | 96 |
| Kensington, AU | 86 |
| Brisbane, AU | 79 |
| Odawara, JP | 69 |
| Christchurch, NZ | 63 |
| Moscow State Universitylocation not on record | 50 |
| Bern, CH | 41 |
| Davis, US | 35 |
| South Kensington, GB | 35 |
| Oskarshamn, SE | 33 |
| Palmerston, AU | 33 |
| Canadian Department of Agriculturelocation not on record | 31 |
| Phoenix, US | 31 |
| BFLlocation not on record | 31 |
| San Luis Obispo, US | 31 |
| College of the Atlantic, Museumlocation not on record | 31 |
| Pretoria, ZA | 30 |
| Granada, ES | 29 |
| ASUlocation not on record | 29 |
| Hobart, AU | 26 |
| BRNUlocation not on record | 26 |
| Kawasaki Shi Tama Ku, JP | 25 |
| QAUlocation not on record | 25 |
| Wlocation not on record | 24 |
| Nagano City, JP | 24 |
| BClocation not on record | 24 |
| Natural History Museum Rotterdamlocation not on record | 23 |
| Auckland, NZ | 23 |
| Vitoria, ES | 22 |
| Provincia di Livornolocation not on record | 21 |
| Severin-McDaniel Insect Collectionlocation not on record | 21 |
| CASlocation not on record | 21 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 20 |
| SLU Artdatabankenlocation not on record | 20 |
| Brussel, BE | 20 |
| Barcelona, ES | 19 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 19 |
| Chiba, JP | 19 |
| Saint Louis, US | 19 |
| Mlocation not on record | 18 |
| Flagstaff, US | 18 |
| Irvine, US | 18 |
| Görlitz, DE | 17 |
| San Sebastián, ES | 17 |
| Oulu, FI | 17 |
| Zürich, CH | 17 |
| Turku, FI | 16 |
| Salzburg, AT | 16 |
| US | 15 |
| Olocation not on record | 15 |
| Chapel Hill, US | 14 |
| Uppsala, SE | 14 |
| BDBClocation not on record | 14 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 14 |
| Alicante, ES | 13 |
| Bergen, NO | 13 |
| Uniwersytet Wrocławskilocation not on record | 13 |
| Trondheim, NO | 13 |
| Tomioka, JP | 12 |
| GJOlocation not on record | 12 |
| CJBGlocation not on record | 12 |
| Paris, FR | 12 |
| JP | 12 |
| Adam Mickiewicz University in Poznańlocation not on record | 11 |
| Zürich, CH | 11 |
| UChlocation not on record | 11 |
| Sagamihara, JP | 10 |
| Wellington, NZ | 10 |
| Tartu, EE | 10 |
| Ensenada, MX | 10 |
| ESP003location not on record | 10 |
| San Bernardino, US | 10 |
| Tsukuba, JP | 10 |
| Salamanca, ES | 10 |
| Northridge, US | 10 |
| Kew, GB | 9 |
| Cape Town, ZA | 9 |
| Long Beach, US | 9 |
| Phyletisches Museum Jenalocation not on record | 9 |
| Madrid, ES | 9 |
| San Isidro, AR | 8 |
| Entomological Society of Latvialocation not on record | 8 |
| Nagatoro-machi, Chichibu-gun, JP | 8 |
| EEZA-CSIClocation not on record | 7 |
| Armidale, AU | 7 |
| TUR-Alocation not on record | 7 |
| Mexico City, MX | 7 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 7 |
| Los Angeles, US | 7 |
| Kuopio, FI | 6 |
| Nijmegen, NL | 6 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 6 |
| Bronx, US | 6 |
| Philadelphia, US | 6 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 6 |
| Osaka, JP | 6 |
| NSW Office of Environment and Heritagelocation not on record | 6 |
| EL PASO, US | 6 |
| Frankfurt am Main | 6 |
| Tokushima, JP | 6 |
| Córdoba, AR | 6 |
| Ciudad Autónoma de Buenos Aires, AR | 5 |
| Tilburg, NL | 5 |
| National Institute of Biological Resourceslocation not on record | 5 |
| CICYTEXlocation not on record | 5 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 5 |
| Pamplona, ES | 5 |
| Frauenfeld, CH | 5 |
| Valparaiso, CL | 4 |
| Parthenon Tama History Museumlocation not on record | 4 |
| Parkville, AU | 4 |
| KOMlocation not on record | 4 |
| Hiratsuka City Museumlocation not on record | 4 |
| Universidad Católica de Santa Maríalocation not on record | 4 |
| Provo, US | 4 |
| Pullman, US | 4 |
| Shinshu Universitylocation not on record | 4 |
| JBSlocation not on record | 3 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 3 |
| NBSIlocation not on record | 3 |
| UIBlocation not on record | 3 |
| Toyama, JP | 3 |
| Rotorua, NZ | 3 |
| Durban, ZA | 3 |
| Museo Achille Folettolocation not on record | 3 |
| CJBNlocation not on record | 3 |
| Bando, JP | 3 |
| Smithfield, AU | 3 |
| San Francisco, US | 3 |
| Buenos Aires, AR | 3 |
| John May Museum of Natural Historylocation not on record | 3 |
| University of British Columbia, Herbariumlocation not on record | 3 |
| GZUlocation not on record | 3 |
| Logan, US | 3 |
| Castelar, AR | 3 |
| BSBIlocation not on record | 3 |
| Fullerton, US | 3 |
| GMBAlocation not on record | 3 |
| Jaén, ES | 3 |
| Tampa, US | 3 |
| Badajoz, ES | 3 |
| Vancouver, CA | 2 |
| Universidad Nacional Mayor de San Marcos, Museo de Historia Naturallocation not on record | 2 |
| PrivatHerblocation not on record | 2 |
| J.F.Oberlin Universitylocation not on record | 2 |
| Santiago de Compostela, ES | 2 |
| Austin, US | 2 |
| Santa Cruz, US | 2 |
| Uniwersytet Warszawskilocation not on record | 2 |
| KURAlocation not on record | 2 |
| Corrientes, AR | 2 |
| Arcata, US | 2 |
| Uniwersytet Jagiellońskilocation not on record | 2 |
| Lausanne, CH | 2 |
| La Paz, MX | 2 |
| Chicago, US | 2 |
| Fredericton Stock Culture Collectionlocation not on record | 2 |
| NMBU:MINAlocation not on record | 2 |
| QVMAGlocation not on record | 2 |
| Mexico City, MX | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| Torreón, MX | 2 |
| SZUlocation not on record | 2 |
| Wollongong, AU | 2 |
| Hunan Geological Museumlocation not on record | 2 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 2 |
| PRClocation not on record | 2 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 2 |
| Bratislava, SK | 1 |
| Albuquerque, US | 1 |
| Fort Worth, US | 1 |
| Fulda, DE | 1 |
| Ural Federal University "B. N. Yeltsin"location not on record | 1 |
| San Jose, US | 1 |
| JBCLMlocation not on record | 1 |
| University of Stellenboschlocation not on record | 1 |
| Sanda, JP | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Podgorica, ME | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| ZRC-SAZUlocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| South African National Biodiversity Institute, Compton Herbariumlocation not on record | 1 |
| Stockholm, SE | 1 |
| WTUlocation not on record | 1 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 1 |
| Córdoba, ES | 1 |
| Namur, BE | 1 |
| TAFORI-LSRClocation not on record | 1 |
| GHPG$location not on record | 1 |
| Catalina Island Conservancylocation not on record | 1 |
| Fukushima Universitylocation not on record | 1 |
| KMNlocation not on record | 1 |
| Palmerston North, NZ | 1 |
| Uberlândia, BR | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| Coimbra, PT | 1 |
| John T. Waterhouse Herbariumlocation not on record | 1 |
| sonstHerblocation not on record | 1 |
| SIHUlocation not on record | 1 |
| Macomb, US | 1 |
| Sendai, JP | 1 |
| Kyoto Universitylocation not on record | 1 |
| Loja, EC | 1 |
| McWane Science Centerlocation not on record | 1 |
| Dresden, DE | 1 |
| Rishon Le Zion, IL | 1 |
| Jyväskylä, FI | 1 |
| Regensburgische Botanische Gesellschaftlocation not on record | 1 |
| Göteborg, SE | 1 |
| Henderson, US | 1 |
| Denver, US | 1 |
| LfUlocation not on record | 1 |
| Honolulu, US | 1 |
228 institutions · 4 656 of 5 037 vouchered records shown · 379 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA18 detections
Where the DNA of Sisymbrium orientale was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found18
Studies independent surveys1
Countries7
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 18 detections have coordinates
Open the map7 countries0
on rocks along edge of oceanon old church wall
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.9 °C 12.9–19.8
Seasonal swing summer↔winter13.9 °C
Max temp (day)19.5 °C 15.2–24.3
Min temp (night)13.1 °C 8.80–16.0
Precipitation63.2 mm/mo 1.70–151
Air humidity61.3 % 59.1–68.1
Moisture balance-35.5 mm/mo -129–109
Vapour deficit647 Pa 468–967
Wind speed2.80 m/s 2.10–5.30
Cloud cover39.8 % 25.8–51.7
CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.