Sisymbrium loeselii
speciesAt a glance
Occurrence records28 415
Data sources11
Biological traits45
DNA specimens47
eDNA detections20
Sources11 archives
Databases and archives Sisymbrium loeselii's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility28 415 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics47 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources45 traits
Occurrence & distributionGBIF28 415 records
Environmental DNA1 datasets · 3 countries20 detections
DNA & barcodingBOLD · NCBI47 specimens
Genome at a glanceCCDB · GoaT243 Mbp
01Narrative
Sisymbrium loeselii, qui a pour nom commun Sisymbre de Loesel ou Vélar de Loesel, est une espèce eurasiatique de plante à fleurs de la famille des Brassicaceae et du genre Sisymbrium.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology13
Fruit length27.5 mm
Fruit length max35 mm
Fruit length min20 mm
Leaf mass107 mg
Leaf size2 525 mm²
⚠ sources differ — LEDA: 2 525 mm² · GIFT: 3 960 mm²
Plant height0.517 m
⚠ sources differ — GIFT: 0.517 m · LEDA: 0.44 m · TRY: 0.572 m
Plant height generative0.604 m
Plant height max1 m
Plant height min0.2 m
Seed length0.79 mm
Seed mass0.086 mg
⚠ sources differ — TRY: 0.086 mg · LEDA: 0.086 mg · GIFT: 0.142 mg
Seed mass max0.44 mg
Seed mass min0.03 mg
Life cycle & reproduction15
Deciduousnessevergreen
Dehiscencedehiscent
Dispersal typeself
Flowering endJul
Flowering startMay
Life formannual or biennial
Life spanannual
⚠ sources differ — TRY: annual · LEDA: strict monocarpic bi-annuals and poly-annuals · GIFT: annual
Lifespan years1.5 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
⚠ sources differ — LEDA: Hemicryptophyte · GIFT: therophyte
Reproduction asexualabsent
Seed number749 903
Self fertilizationpresent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment11
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max1 900 m
Elevation min1 200 m
Epiphyteterrestrial
Fruit typecapsule
Growth formherb
Habitat GIFTmeadows, mountains, sand, steppe
Mycorrhiza typenon-mycorrhizal
Woodinessnon-woody
Physiology & chemistry3
Leaf dry-matter content (LDMC)195 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)23.5 mm²/mg
⚠ sources differ — TRY: 23.5 mm²/mg · LEDA: 20.42 mm²/mg · GIFT: 18.23 mm²/mg
Other traits1
Diaspore typeseed
05DNA & barcoding47 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sisymbrium loeselii has left across the world's sequence archives.
At a glance
DNA specimens47
Marker genes8
GenBank sequences10
eDNA detections20
Countries3
The DNA barcodea real sequence read deposited for this species
GTCGATACCTAGAACAAAACGACCCGAGAACGCTCGATCATCACTATCGGTGGGCCGGTTTCTTAACCGATCCTGTTCCCACCGATTCCG …
Sisymbrium loeselii voucher ALT23-195 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK4★rbcL5★rbcL-like★rbcLa★trnL-F★ITS1★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Sisymbrium loeselii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size243 033 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
THIS GENOME Sisymbrium loeselii0.24 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 14 n = 7
Ploidy2× diploid · measured
Chromosome records14–142n range14median14mode36records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1436×GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl · CCDB · nw-europe-fl +9
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1974b: Index of chromosome numbers of Slovakian flora Part 4. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 23: 1-23.
CCDB · slov-fl — Dvořák F. & Dadáková B., 1975c: [Report], pp. 508-509. - In: Löve Á. (ed.), IOPB Chromosome number report XLIX, Taxon 24 /4.
CCDB · slov-fl — Dvořák F. & Dadáková B., 1975b: Study of chromosomes of angiosperms 2. - Scripta Fac. Sci. Nat. Univ. J. E. Purkynianae Brun. 1, 5: 31-50.
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2265
CCDB · poland — Frey L., Mizianty M. and Mirek Z. 1981. Chromosome numbers of Polish vascular plants. Fragm. Flor. Geobot. 27, 581-590.
CCDB · poland — Pogan E., Czapik R. and Jankun A. et al. 1985. Further studies in chromosome numbers of Polish Angiosperms Part XVIII. Acta Biol. Cracov. Ser. Bot. 27, 57-74.
CCDB · ipcn-api-dl — Pogan, E., R. CZAPIK & A. Jankun. 1985. Further studies in chromosome numbers of Polish angiosperms. Part XVIII. Acta Biol. Cracov., Ser. Bot. 27: 57–74.
CCDB · ipcn-api-dl — Ančev, M. E. 1983. Karyology and reproductive characteristics of some weedy and ruderal Cruciferae species in Bulgaria. In: Third National Botanical Conference, Sofia, 26-30. 10(1981): 232–233.
CCDB · ipcn-api-dl — Frey, L., M. Mizianty & Z. Mirek. 1981. Chromosome numbers of Polish vascular plants. Fragm. Florist. Geobot. 27: 581–590.
CCDB · ipcn-api-dl — Krasnikov, A. A. & M. N. Lomonosova. 1990. Chromosome numbers in representatives of some families of vascular plants in the flora of the Novosibirsk region. I. Bot. Žhurn. (Moscow & Leningrad) 75: 116–118.
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Ančev, M. E. 1981. In Chromosome number reports LXXIII. Taxon 30:855.
CCDB · ipcn-api-dl — Dvorak, F., F. Grull, K. Sutory & B. Dadakova. 1981. In Chromosome number reports LXXIII. Taxon 30:844.
CCDB · ipcn-api-dl — Vachova, M. 1974a. In Index to chromosome numbers of Slovakian flora. Part 4. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 23: 1–23.
CCDB · ipcn-api-dl — Dvorak, F. & B. Dadakova. 1975a. In IOPB chromosome number reports XLIX. Taxon 24: 501–516.
CCDB · book-ipcn67-71 — PODLECH, D., & A. DIETERLE. 1969. Chromosomenstudien an afghanischen Pflanzen. Candollea 24: 185-243.
CCDB · book-ipcn75-78 — Vachova 1974a
CCDB · book-ipcn75-78 — Dvorak & Dadakova 1975a
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian Flora. (Part 4). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 23: 1-23.
CCDB · eflora
CCDB · brass — Podlech & Dieterle
CCDB · brass — Ancev
CCDB · brass — Mulligan
CCDB · brass — Mjovsky et al.
CCDB · brass — Dvork & Dadkov
CCDB · brass — Dvork et al.
CCDB · brass — Javurkov-Jarolimov
CCDB · brass — Frey et al.
CCDB · brass — Pogan et al.
CCDB · brass — Krasnikov & Lomonosova
CCDB · book-atlas-flowering-plants — Jaretzky 1932
CCDB · Cave1957 — Mulligan
n 714×CCDB · book-ipcn65 · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +1
CCDB · book-ipcn65 — Raj 1965
CCDB · ipcn-api-dl — Aryavand, A. 1978. Contribution a l'etude cytotaxonomique des Cruciferes de l'Iran. II. Bull. Soc. Neuchateloise Sci. Nat. 101: 95–106.
CCDB · ipcn-api-dl — Al-Shehbaz, I. A. & M. M. Al-Omar. 1982. In IOPB chromosome number reports LXXVI. Taxon 31: 587–589.
CCDB · ipcn-api-dl — Khatoon, S. & S. I. Ali. 1993. Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi.
CCDB · ipcn-api-dl — Dvorak, F., F. Grull, K. Sutory & B. Dadakova. 1981. In Chromosome number reports LXXIII. Taxon 30:844.
CCDB · ipcn-api-dl — Aryavand, A. 1977a. In IOPB chromosome number reports LVIII. Taxon 26: 557–565.
CCDB · book-ipcn75-78 — Aryavand l 977a
CCDB · brass — Raj
CCDB · brass — Raina & Gohil
CCDB · brass — Aryavand
CCDB · brass — Al-Shehbaz & Al-Omar
CCDB · brass — Jaretzky
CCDB · brass — Khatoon & Ali
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type28 415 records
Wild obs. + sensor22 868
Museum / vouchered5 481
Cultivated / captive2
Other64
Origin
Native1
Introduced332
Range
Area of Occupancy AOO54 588 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy68% within 1 km
≤100 m 9 351≤1 km 2 604≤10 km 4 789>10 km 787
17 531 georeferenced · 5 337 without coordinates
Open the mapobservation + sensor22 868
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy50% within 1 km
≤100 m 635≤1 km 1 104≤10 km 1 286>10 km 427
3 452 georeferenced · 2 029 without coordinates
Open the institutions mapphysical evidence5 481
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 1
1 georeferenced · 1 without coordinates
Open the mapnot free-living2
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions98 of 183 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 1 039 |
| Moscow State Universitylocation not on record | 337 |
| Helsinki, FI | 322 |
| LDlocation not on record | 221 |
| Uniwersytet Warszawskilocation not on record | 204 |
| Olocation not on record | 129 |
| Adam Mickiewicz University in Poznańlocation not on record | 89 |
| QAUlocation not on record | 79 |
| SLU Artdatabankenlocation not on record | 78 |
| Wlocation not on record | 73 |
| Görlitz, DE | 71 |
| Oskarshamn, SE | 68 |
| Oulu, FI | 68 |
| GMBAlocation not on record | 63 |
| DAOlocation not on record | 62 |
| Tartu, EE | 62 |
| Kuopio, FI | 59 |
| Beijing, CN | 57 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 56 |
| MeiseBGlocation not on record | 55 |
| Missoula, US | 47 |
| Chadron, US | 47 |
| Victoria, CA | 44 |
| BRNUlocation not on record | 43 |
| GJOlocation not on record | 40 |
| Turku, FI | 36 |
| Provincia di Livornolocation not on record | 33 |
| Bronx, US | 31 |
| Berlin, DE | 29 |
| Vancouver, CA | 27 |
| South Kensington, GB | 26 |
| Wuzhou, CN | 26 |
| WTUlocation not on record | 25 |
| BFLlocation not on record | 25 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 23 |
| Trondheim, NO | 23 |
| TUR-Alocation not on record | 22 |
| Nanjing, CN | 22 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 21 |
| Saint Louis, US | 20 |
| Provo, US | 20 |
| Pullman, US | 20 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 20 |
| Tallinn, EE | 19 |
| WNNUlocation not on record | 19 |
| Uniwersytet Jagiellońskilocation not on record | 18 |
| Bergen, NO | 18 |
| UniKSlocation not on record | 17 |
| Mlocation not on record | 16 |
| Bozeman, US | 15 |
| University of Alberta Museumslocation not on record | 14 |
| Salzburg, AT | 14 |
| Madison, US | 14 |
| Denver, US | 14 |
| Brussel, BE | 14 |
| Logan, US | 12 |
| Moscow, US | 12 |
| Jyväskylä, FI | 11 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 10 |
| St. Paul, US | 10 |
| Chapel Hill, US | 10 |
| Institute of the biological problems of the North FEB RASlocation not on record | 10 |
| Uppsala, SE | 9 |
| Kunming, CN | 9 |
| DBF-NHMDlocation not on record | 9 |
| Chengdu, CN | 8 |
| Québec, CA | 8 |
| Guangzhou, CN | 8 |
| Brookings, US | 8 |
| Herbarium of South China Botanical Gardenlocation not on record | 7 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 7 |
| Xining, CN | 7 |
| Lincoln, US | 7 |
| Yangling, CN | 7 |
| Zürich, CH | 7 |
| Whitehorse, CA | 7 |
| KMNlocation not on record | 7 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 7 |
| BIO-UNIPIlocation not on record | 6 |
| Lanzhou, CN | 6 |
| Boise, US | 6 |
| GB | 6 |
| IDElocation not on record | 6 |
| Natural History Museum Rotterdamlocation not on record | 6 |
| Burlington, US | 6 |
| Porvoo, FI | 6 |
| Bern, CH | 6 |
| Spearfish, US | 6 |
| Science Museum of Minnesotalocation not on record | 5 |
| Frankfurt am Main | 5 |
| John May Museum of Natural Historylocation not on record | 5 |
| Albuquerque, US | 5 |
| Flagstaff, US | 5 |
| Dekalb, US | 5 |
| Durango, US | 5 |
| NMBU:MINAlocation not on record | 5 |
| BClocation not on record | 5 |
| Canadian Department of Agriculturelocation not on record | 5 |
| Zürich, CH | 5 |
| H-Schuhwlocation not on record | 5 |
| Salamanca, ES | 4 |
| Uniwersytet Opolskilocation not on record | 4 |
| Nijmegen, NL | 4 |
| Edinburgh, GB | 4 |
| PRClocation not on record | 4 |
| New Haven, US | 4 |
| Ann Arbor, US | 4 |
| Saint John, CA | 3 |
| SZUlocation not on record | 3 |
| Acadia Universitylocation not on record | 3 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 3 |
| Uniwersytet Śląski w Katowicachlocation not on record | 3 |
| Caldwell, US | 3 |
| Bloomington, US | 3 |
| Research Collection of B. A. Bennettlocation not on record | 3 |
| Pocatello, US | 3 |
| TADlocation not on record | 3 |
| Grand Junction, US | 3 |
| Claremont, US | 3 |
| Corvallis, US | 3 |
| ASUlocation not on record | 2 |
| Pittsburg, US | 2 |
| Henderson, US | 2 |
| Odawara, JP | 2 |
| Toronto, CA | 2 |
| Bratislava, SK | 2 |
| University of British Columbia, Herbariumlocation not on record | 2 |
| Philadelphia, US | 2 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 2 |
| MAlocation not on record | 2 |
| Santiago de Compostela, ES | 2 |
| BGBMlocation not on record | 2 |
| Philadelphia, US | 2 |
| Montréal, CA | 2 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 2 |
| Fort Worth, US | 2 |
| DOI/NPS, Greenbelt Parklocation not on record | 2 |
| Emporia, US | 2 |
| Chongqing Museumlocation not on record | 2 |
| TROMlocation not on record | 2 |
| ESP003location not on record | 2 |
| Rocky Mountain Biological Laboratorylocation not on record | 1 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 1 |
| BioFokuslocation not on record | 1 |
| Tampa, US | 1 |
| Royal Botanical Gardenslocation not on record | 1 |
| Frauenfeld, CH | 1 |
| LfUlocation not on record | 1 |
| Columbia, US | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 1 |
| Yellowstone National Park Herbariumlocation not on record | 1 |
| Chinese Academy of Sciences, Xinjiang Institute of Ecology and Geography, Herbariumlocation not on record | 1 |
| Honolulu, US | 1 |
| Xiamen, CN | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| B.A. Bennett Herbariumlocation not on record | 1 |
| NBSIlocation not on record | 1 |
| Otaru, JP | 1 |
| DULlocation not on record | 1 |
| Urumqi, CN | 1 |
| Knoxville, US | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| USFSlocation not on record | 1 |
| Tulane Universitylocation not on record | 1 |
| Macomb, US | 1 |
| Kew, GB | 1 |
| Bangkok, TH | 1 |
| Turpan Eremophytes Botanical Garden, Herbariumlocation not on record | 1 |
| LINUlocation not on record | 1 |
| Sagamihara, JP | 1 |
| Phoenix, US | 1 |
| Regensburgische Botanische Gesellschaftlocation not on record | 1 |
| Tilburg, NL | 1 |
| FLASlocation not on record | 1 |
| Stockholm, SE | 1 |
| College Park, US | 1 |
| BG-NMNHSlocation not on record | 1 |
| AUAlocation not on record | 1 |
| McWane Science Centerlocation not on record | 1 |
| Göteborg, SE | 1 |
| USFS/BHSClocation not on record | 1 |
| València, ES | 1 |
183 institutions · 4 522 of 5 481 vouchered records shown · 886 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA20 detections
Where the DNA of Sisymbrium loeselii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found20
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 20 detections have coordinates
Open the map3 countries0
Dry, gravelly roadsideDisturbed ground with other introduced speci…On the hillsidecheatgrass, rabbitbrush, agropyrum cristatum
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median16.1 °C 5.50–26.2
Seasonal swing summer↔winter32.0 °C
Max temp (day)22.2 °C 10.5–32.0
Min temp (night)9.20 °C -1.00–18.6
Precipitation42.9 mm/mo 13.5–80.2
Air humidity49.1 % 41.3–56.6
Moisture balance-88.8 mm/mo -170–-23.5
Vapour deficit899 Pa 424–2,032
Wind speed2.70 m/s 1.70–4.50
Cloud cover37.0 % 29.2–44.3
CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.