Sisymbrium irio
speciesAt a glance
Occurrence records26 769
Data sources14
Biological traits57
DNA specimens32
eDNA detections21
Sources14 archives
Databases and archives Sisymbrium irio's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility26 769 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics32 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources57 traits
Chemical compositionLOTUS · NPASS6 compounds
Occurrence & distributionGBIF26 769 records
Environmental DNA2 datasets · 5 countries21 detections
DNA & barcodingBOLD · NCBI32 specimens
Genome at a glanceCCDB · GIFT · GoaT≈246 Mbp
01Narrative
Sisymbrium irio, communément appelé Sisymbre irio ou Sisymbre vélaret, est une espèce de plante herbacée appartenant à la famille des Brassicaceae (crucifères). C’est une plante annuelle de 20 à 60 cm de hauteur, avec des feuilles basale pennatiséquées. Elle est originaire d’Europe du Sud, du Moyen-Orient jusqu’en Asie centrale, et d’Afrique du Nord. Utilisée en tisane sucrée avec du miel qui a la réputation de calmer les toux grasses et de lutter efficacement contre les enrouements et les extinctions de voix.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology18
Fruit length45 mm
⚠ sources differ — AusTraits: 45 mm · GIFT: 30.25 mm
Fruit length max50 mm
Fruit length min25 mm
Fruit width1 mm
Fruit width max1 mm
Fruit width min1 mm
Leaf length205 mm
Leaf length max200 mm
Leaf length min60 mm
Plant height0.312 m
⚠ sources differ — GIFT: 0.312 m · AusTraits: 0.6 m · LEDA: 0.225 m · TRY: 0.353 m
Plant height generative0.3 m
Plant height max1 m
Plant height min0.1 m
Seed length0.95 mm
⚠ sources differ — TRY: 0.95 mm · AusTraits: 1.25 mm
Seed length max0.8 mm
Seed mass0.101 mg
⚠ sources differ — TRY: 0.101 mg · LEDA: 0.088 mg · GIFT: 0.098 mg
Seed mass max0.2 mg
Seed mass min0.05 mg
Life cycle & reproduction18
Deciduousnessevergreen
Dehiscencedehiscent
Dispersal typeself
Flower colouryellow
Flower length max4 mm
Flower length min3 mm
Flowering endApr
Flowering startMay
Flowering timennnnnnyyyyyy
Life formannual
Life spanannual
⚠ sources differ — TRY: annual · AusTraits: annual biennial · GIFT: annual
Lifespan years2 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Reproduction asexualabsent
Resprouting capacityfire_killed
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max3 500 m
Elevation mean1 903 m
Elevation min0 m
Epiphyteterrestrial
Fruit typesilique
Growth formherb
Habitat GIFTLowland
Leaf compoundnesssimple
Leaf formpinnatifid
Mycorrhiza type0.000107814
Woodinessnon-woody
Physiology & chemistry3
Leaf dry-matter content (LDMC)160 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)20.14 mm²/mg
Other traits2
Diaspore typeseed
Leaf arrangementrosette
03Chemical composition6 compounds
Compounds documented for Sisymbrium irio across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Labdane diterpenoids $ Norlabdane diterpenoids2
Glucosinolates1
Norlabdane diterpenoids1
Ergostane steroids1
Labdane diterpenoids1
Documented compounds6 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1S,4aR,5S,8aR)-5-[2-(furan-3-yl)-2-oxoethyl]-1,4a-dimethyl-6-methylidene-3,4,5,7,8,8a-hexahydro-2H-naphthalene-1-carboxylic acid | present | NPASS | |
| (1S,4aR,5S,8aS)-5-[(3S)-4-carboxy-3-methylbutyl]-1,4a-dimethyl-6-methylidene-3,4,5,7,8,8a-hexahydro-2H-naphthalene-1-carboxylic acid | present | NPASS | |
| 24-Methylenecholesterol | present | LOTUS | |
| [(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl] (1E)-2-methyl-N-sulfooxypropanimidothioate | present | LOTUS | |
| Junicedric acid | present | NPASS | |
| Lambertiainc Acid | present | NPASS |
05DNA & barcoding32 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sisymbrium irio has left across the world's sequence archives.
At a glance
DNA specimens32
Marker genes5
GenBank sequences10
eDNA detections21
Countries5
The DNA barcodea real sequence read deposited for this species
GGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGTGTC …
Sisymbrium irio isolate Peru170420 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL5★rbcLa★ITS3★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GIFT · GoaT · NCBI
The complete instruction manual Sisymbrium irio carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size≈245 550 082 bp assembly estimate
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
THIS GENOME Sisymbrium irio0.25 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 14 n = 7
Ploidydiploid inferred
Chromosome records14–562n range16median14mode94records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1446×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 +5
CCDB · iapt — IAPT/IOPB Chromosome Data 8
CCDB · ipcn-api-dl — Carrique, M. C. & A. J. Martínez. 1984. Números de cromosómas de Cruciferae 1. Parodiana 3: 113–128.
CCDB · ipcn-api-dl — Ghaffari, S. M. 1987. Chromosome studies in some flowering plants of Iran. Rev. Cytol. Biol. Vég., Bot. 10: 3–8.
CCDB · ipcn-api-dl — Natarajan, G. 1988. étude caryosystiématique de quelques dicotyledones de la Garrigue Languedocienne. Nat. Monspel. 52: 85–123.
CCDB · ipcn-api-dl — Díaz Lifante, Z., T. Luque & C. S. Bárbara. 1992. Chromosome numbers of plants collected during Iter Mediterraneum II in Israel. Bocconea 3: 229–250.
CCDB · ipcn-api-dl — Mĕsíček, J. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Natarajan, G. 1981. In Chromosome number reports LXXII. Taxon 30: 698–699.
CCDB · ipcn-api-dl — Sidhu, M. K. 1979. Distributional and cytological studies of the weed flora of cultivable fields of Patiala district (Panjab). Ph.D. Thesis, Patiala. 1-230. 1979.
CCDB · ipcn-api-dl — Miceli, P., A. SPAZZAFUMO & F. GARBARI. 1978. Numeri cromosomici per la flora Italiana: 423-433. Inform. Bot. Ital. 10: 110–119.
CCDB · ipcn-api-dl — Runemark, H. 2000. Mediterranean chromosome number reports 10 (1110--1188). Fl. Medit. 10: 386–402.
CCDB · book-ipcn73-74 — VAN LOON, J. 1974. A cytological investigation of flowering plants from the Canary islands. Acta Bot. Neerl. 23: 113-124.
CCDB · eflora
CCDB · brass — Carrique & Martnez
CCDB · brass — van Loon
CCDB · brass — Dalgaard
CCDB · brass — Mescek
CCDB · brass — Natarajan
CCDB · brass — Khoshoo
CCDB · brass — Lessani & Chariat-Panahi
CCDB · brass — Ghaffari
CCDB · brass — Daz Lifante et al.
CCDB · Cave1957 — Khoahoo a
CCDB · CromoCat 2015 — Dalgaard, V. (1986a). Chromosome studies in flowering plants from Macaronesia. Anales Jard. Bot. Madrid 43: 83-111.
CCDB · CromoCat 2015 — Govindaraj, N. (1988). Étude caryosystematique de quelques Dicotyledones de la garrigue languedocienne. Nat. Monsp. Bot. 52: 85-123.
CCDB · CromoCat 2015 — Jaretzky, R. (1932). Beizichungen zwischen chromosomenzahl und systematik bei den Cruciferen. Jahrb. Wiss. Bot. 76: 485-527.
CCDB · CromoCat 2015 — Khoshoo, T. N. & Sharma, V. B. (1959). Biosystematics of Sisymbrium irio complex. VI. Reciprocal pollinations and seed failure. Caryologia 12: 71-97.
CCDB · CromoCat 2015 — Khoshoo, T. N. (1955). Biosystematics of the Sisymbrium irio complex. Nature 176: 608.
CCDB · CromoCat 2015 — Khoshoo, T. N. (1958a). Biosystematic of Sisymbrium irio complex. I. Modifications in phenotype. Caryologia 11: 109-132.
CCDB · CromoCat 2015 — Khoshoo, T. N. (1958b). Biosystematics of Sisymbrium irio complex. II. Morphology of the races. Caryologia 11: 133-157.
CCDB · CromoCat 2015 — Khoshoo, T. N. (1959a). Biosystematics of Sisymbrium irio complex. III. Cytology of the races. Caryologia 11: 297-318.
CCDB · CromoCat 2015 — Khoshoo, T. N. (1959b). Biosystematics of Sisymbrium irio complex. IV. Origin of triploid, hexaploid and octoploid. Caryologia 11: 319-329.
CCDB · CromoCat 2015 — Khoshoo, T. N. (1959c). Biosystematics of Sisymbrium irio complex. V. Mode of pollination. Caryologia 11: 330-333.
CCDB · CromoCat 2015 — Khoshoo, T. N. (1959d). Biosystematics of Sisymbrium irio complex. VII. Meiosis in hybrids. Caryologia 12: 98-103.
CCDB · CromoCat 2015 — Khoshoo, T. N. (1960a). Biosystematic of Sisymbrium irio complex. IX. Genome analysis. J. Indian Bot. Soc. 39: 217-226.
CCDB · CromoCat 2015 — Lessani, H. & Chairat-Panahi, S. (1979). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXV]. Taxon 28(5/6): 635-636.
CCDB · CromoCat 2015 — Loon van, J. C. (1974). A cytological investigation of flowering plants from the Canary islands. Acta Bot. Neerl. 23: 113-124.
CCDB · CromoCat 2015 — M?sí?ek J. et Jarolímová-Jav?rková V. (1992). List of chromosome numbers of the Czech vascular plants. Academia, Praha. p. 1-144.
CCDB · CromoCat 2015 — Natarajan, G. (1981). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXII]. Taxon 30(3): 698-699.
CCDB · CromoCat 2015 — Runemark, H. (2000). Mediterranean chromosome number reports-10. Fl. Medit. 10: 386-402.
CCDB · CromoCat 2015 — Titz, W. (1969b). Chromosomenzahlen dreier europäischer Cruciferen. Ber. Deutsch. Bot. Ges. 82(7/8):553-555
+2 more references
2n 2820×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · brass +3
CCDB · ipcn-api-dl — Bir, S. S. & M. Sidhu. 1980. Cyto-palynological studies on weed flora of cultivable lands of Patiala district (Punjab). J. Palynol. 16: 85–105.
CCDB · ipcn-api-dl — Johnston. 2005. Evolution of genome size in Brassicaceae. Ann. Bot. (Oxford) 95: 229–235.
CCDB · book-ipcn67-71 — PODLECH, D., & A. DIETERLE. 1969. Chromosomenstudien an afghanischen Pflanzen. Candollea 24: 185-243.
CCDB · brass — Khoshoo
CCDB · brass — Bir & Sidhu
CCDB · brass — Podlech & Dieterle
CCDB · kew — Johnston JS, Pepper AE, Hall AE, Chen ZJ, Hodnett G, Drabek J, Lopez R, Price HJ. 2005. Evolution of genome size in Brassicaceae. Annals of Botany 95: 229-235.
CCDB · CromoCat 2015 — Khoshoo, T. N. & Sharma, V. B. (1959). Biosystematics of Sisymbrium irio complex. VI. Reciprocal pollinations and seed failure. Caryologia 12: 71-97.
CCDB · CromoCat 2015 — Khoshoo, T. N. (1955). Biosystematics of the Sisymbrium irio complex. Nature 176: 608.
CCDB · CromoCat 2015 — Khoshoo, T. N. (1958a). Biosystematic of Sisymbrium irio complex. I. Modifications in phenotype. Caryologia 11: 109-132.
CCDB · CromoCat 2015 — Khoshoo, T. N. (1958b). Biosystematics of Sisymbrium irio complex. II. Morphology of the races. Caryologia 11: 133-157.
CCDB · CromoCat 2015 — Khoshoo, T. N. (1959a). Biosystematics of Sisymbrium irio complex. III. Cytology of the races. Caryologia 11: 297-318.
CCDB · CromoCat 2015 — Khoshoo, T. N. (1959b). Biosystematics of Sisymbrium irio complex. IV. Origin of triploid, hexaploid and octoploid. Caryologia 11: 319-329.
CCDB · CromoCat 2015 — Khoshoo, T. N. (1959c). Biosystematics of Sisymbrium irio complex. V. Mode of pollination. Caryologia 11: 330-333.
CCDB · CromoCat 2015 — Khoshoo, T. N. (1959d). Biosystematics of Sisymbrium irio complex. VII. Meiosis in hybrids. Caryologia 12: 98-103.
CCDB · CromoCat 2015 — Podlech, D. & A. Dieterle. (1969). Chromosomenstudien an afghanischen Pflanzen. Candollea 24(2): 185-243.
GIFT · GIFT (floras)
2n 4212×CCDB · fl-europaea · CCDB · brass · CCDB · CromoCat 2015 +1
CCDB · fl-europaea — Khoshoo, 1959
CCDB · brass — Khoshoo
CCDB · CromoCat 2015 — Khoshoo, T. N. & Sharma, V. B. (1959). Biosystematics of Sisymbrium irio complex. VI. Reciprocal pollinations and seed failure. Caryologia 12: 71-97.
CCDB · CromoCat 2015 — Khoshoo, T. N. (1955). Biosystematics of the Sisymbrium irio complex. Nature 176: 608.
CCDB · CromoCat 2015 — Khoshoo, T. N. (1958a). Biosystematic of Sisymbrium irio complex. I. Modifications in phenotype. Caryologia 11: 109-132.
CCDB · CromoCat 2015 — Khoshoo, T. N. (1958b). Biosystematics of Sisymbrium irio complex. II. Morphology of the races. Caryologia 11: 133-157.
CCDB · CromoCat 2015 — Khoshoo, T. N. (1959a). Biosystematics of Sisymbrium irio complex. III. Cytology of the races. Caryologia 11: 297-318.
CCDB · CromoCat 2015 — Khoshoo, T. N. (1959b). Biosystematics of Sisymbrium irio complex. IV. Origin of triploid, hexaploid and octoploid. Caryologia 11: 319-329.
CCDB · CromoCat 2015 — Khoshoo, T. N. (1959c). Biosystematics of Sisymbrium irio complex. V. Mode of pollination. Caryologia 11: 330-333.
CCDB · CromoCat 2015 — Khoshoo, T. N. (1959d). Biosystematics of Sisymbrium irio complex. VII. Meiosis in hybrids. Caryologia 12: 98-103.
GIFT · GIFT (floras)
2n 5611×CCDB · brass · CCDB · CromoCat 2015 · GIFT · GIFT (floras)
CCDB · brass — Khoshoo
CCDB · CromoCat 2015 — Khoshoo, T. N. & Sharma, V. B. (1959). Biosystematics of Sisymbrium irio complex. VI. Reciprocal pollinations and seed failure. Caryologia 12: 71-97.
CCDB · CromoCat 2015 — Khoshoo, T. N. (1955). Biosystematics of the Sisymbrium irio complex. Nature 176: 608.
CCDB · CromoCat 2015 — Khoshoo, T. N. (1958a). Biosystematic of Sisymbrium irio complex. I. Modifications in phenotype. Caryologia 11: 109-132.
CCDB · CromoCat 2015 — Khoshoo, T. N. (1958b). Biosystematics of Sisymbrium irio complex. II. Morphology of the races. Caryologia 11: 133-157.
CCDB · CromoCat 2015 — Khoshoo, T. N. (1959a). Biosystematics of Sisymbrium irio complex. III. Cytology of the races. Caryologia 11: 297-318.
CCDB · CromoCat 2015 — Khoshoo, T. N. (1959b). Biosystematics of Sisymbrium irio complex. IV. Origin of triploid, hexaploid and octoploid. Caryologia 11: 319-329.
CCDB · CromoCat 2015 — Khoshoo, T. N. (1959c). Biosystematics of Sisymbrium irio complex. V. Mode of pollination. Caryologia 11: 330-333.
CCDB · CromoCat 2015 — Khoshoo, T. N. (1959d). Biosystematics of Sisymbrium irio complex. VII. Meiosis in hybrids. Caryologia 12: 98-103.
GIFT · GIFT (floras)
2n 163×CCDB · iber-fl · CCDB · book-atlas-flowering-plants
CCDB · iber-fl — Chromosome atlas of flowering plants. Darlintong, C. D. & A. P. Wylie.*(1955).
CCDB · book-atlas-flowering-plants — Baez-Major 1932
CCDB · book-atlas-flowering-plants — Jaretzky 1932
2n 182×CCDB · iber-fl · CCDB · CromoCat 2015
CCDB · iber-fl — Estudio cariolgico de algunas crucferas y su interpretacin en la sistemtica. Baez Mayor, A.Cavanillesia6(1-2): 59-103(1933).
CCDB · CromoCat 2015 — Baker, H. G. (1949). Investigations in the Geraniaceae. Carnegie Inst. Wash. Year Book 48: 105-106.
2n 212×CCDB · brass
CCDB · brass — Khoshoo
2n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Kumar, S, Kumari, S & Gupta, R. C (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1789-1790
n 719×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · brass +1
CCDB · ipcn-api-dl — Aryavand, A. 1978. Contribution a l'etude cytotaxonomique des Cruciferes de l'Iran. II. Bull. Soc. Neuchateloise Sci. Nat. 101: 95–106.
CCDB · ipcn-api-dl — Ward, D. E. 1983. Chromosome counts from New Mexico and southern Colorado. Phytologia 54: 302–309.
CCDB · ipcn-api-dl — Al-Shehbaz, I. A. & M. M. Al-Omar. 1982. In IOPB chromosome number reports LXXVI. Taxon 31: 587–589.
CCDB · ipcn-api-dl — Sidhu, M. K. 1979. Distributional and cytological studies of the weed flora of cultivable fields of Patiala district (Panjab). Ph.D. Thesis, Patiala. 1-230. 1979.
CCDB · ipcn-api-dl — Bir, S. S. & M. Sidhu. 1980. Cyto-palynological studies on weed flora of cultivable lands of Patiala district (Punjab). J. Palynol. 16: 85–105.
CCDB · ipcn-api-dl — Lessani, H. & S. Chariat-panahi. 1979. In IOPB chromosome number reports LXV. Taxon 28: 635–636.
CCDB · ipcn-api-dl — Aryavand, A. 1977a. In IOPB chromosome number reports LVIII. Taxon 26: 557–565.
CCDB · book-ipcn75-78 — Aryavand 1977a
CCDB · brass — Raina & Gohil
CCDB · brass — Aryavand
CCDB · brass — Al-Shehbaz & Al-Omar
CCDB · brass — Jaretzky
CCDB · brass — Rollins & Rdenberg
CCDB · brass — Ward
CCDB · CromoCat 2015 — Al-Shehbaz, I. A. & Al-Omar, M. M. (1982). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXVII]. Taxon 31(3): 587-589.
CCDB · CromoCat 2015 — Aryavand, A. (1977b). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LVIII]. Taxon 26(5/6): 561-565.
CCDB · CromoCat 2015 — Aryavand, A. (1978). Contribution à l'étude cytotaxonomique des Crucifères de l'Iran. II. Bull. Soc. Neuchât. Sci. Nat. 101: 95-106.
CCDB · CromoCat 2015 — Titz, W. (1969b). Chromosomenzahlen dreier europäischer Cruciferen. Ber. Deutsch. Bot. Ges. 82(7/8):553-555
n 1410×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +3
CCDB · iapt — IAPT/IOPB Chromosome Data 12
CCDB · ipcn-api-dl — Natarajan, G. 1981. In Chromosome number reports LXXII. Taxon 30: 698–699.
CCDB · ipcn-api-dl — Koul, A. K., A. K. Wakhlu & J. L. KARIHALOO. 1976a. Chromosome numbers of some flowering plants of Jammu (western Himalayas). II. CIS Chromosome Inform. Serv. 20: 32–33.
CCDB · book-ipcn75-78 — Koul et al. 1976a
CCDB · book-ipcn73-74 — AMIN, A. 1973. In IOPB chromosome number reports XXXIX. Taxon 22: 115-118.
CCDB · brass — Amin
CCDB · brass — Koul et al.
CCDB · brass — Sidhu
CCDB · CromoCat 2015 — Amin, A. (1973). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXXIX]. Taxon 22(1): 115.
CCDB · CromoCat 2015 — Kumar, S, Kumari, S & Gupta, R. C (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1789-1790
n 92×CCDB · iber-fl · CCDB · CromoCat 2015
CCDB · iber-fl — Estudio cariolgico de algunas crucferas y su interpretacin en la sistemtica. Baez Mayor, A.Cavanillesia6(1-2): 59-103(1933).
CCDB · CromoCat 2015 — Baker, H. G. (1949). Investigations in the Geraniaceae. Carnegie Inst. Wash. Year Book 48: 105-106.
n 211×GIFT · GIFT (floras)
GIFT · GIFT (floras)
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelScaffold
Completeness97.2% BUSCO
08Occurrence & distribution
Record type26 769 records
Wild obs. + sensor21 396
Museum / vouchered5 211
Cultivated / captive2
Other160
Origin
Native2 045
Introduced4 357
Range
Area of Occupancy AOO52 864 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy68% within 1 km
≤100 m 8 022≤1 km 3 759≤10 km 5 401>10 km 224
17 406 georeferenced · 3 990 without coordinates
Open the mapobservation + sensor21 396
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy55% within 1 km
≤100 m 594≤1 km 821≤10 km 967>10 km 188
2 570 georeferenced · 2 641 without coordinates
Open the institutions mapphysical evidence5 211
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 2
2 georeferenced
Open the mapnot free-living2
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions160 of 266 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| QAUlocation not on record | 380 |
| ASUlocation not on record | 364 |
| San Diego, US | 291 |
| Adelaide, AU | 224 |
| Riverside, US | 198 |
| Claremont, US | 158 |
| València, ES | 124 |
| Phoenix, US | 123 |
| MAlocation not on record | 113 |
| Austin, US | 96 |
| South Kensington, GB | 91 |
| Mount Annan, AU | 89 |
| Museo Entomologico de Leonlocation not on record | 88 |
| Canberra, AU | 86 |
| Santa Barbara, US | 82 |
| Flagstaff, US | 80 |
| Berlin, DE | 76 |
| Brisbane, AU | 74 |
| EL PASO, US | 73 |
| Bronx, US | 59 |
| Kensington, AU | 59 |
| BIO-UNIPIlocation not on record | 57 |
| BClocation not on record | 52 |
| Mexico City, MX | 49 |
| Durango, MX | 48 |
| GMBAlocation not on record | 47 |
| Mexico City, MX | 47 |
| Fort Worth, US | 45 |
| College of the Atlantic, Museumlocation not on record | 44 |
| LDlocation not on record | 44 |
| Vitoria, ES | 41 |
| Saint Louis, US | 36 |
| Zürich, CH | 36 |
| BDBClocation not on record | 35 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 35 |
| Córdoba, AR | 33 |
| Albuquerque, US | 32 |
| Davis, US | 32 |
| Canadian Department of Agriculturelocation not on record | 30 |
| Wlocation not on record | 30 |
| Irvine, US | 30 |
| CASlocation not on record | 27 |
| Moscow State Universitylocation not on record | 27 |
| Hermosillo, MX | 26 |
| Zürich, CH | 26 |
| Palmerston, AU | 23 |
| Alicante, ES | 23 |
| San Sebastián, ES | 23 |
| CJBGlocation not on record | 23 |
| Granada, ES | 22 |
| Barcelona, ES | 22 |
| MeiseBGlocation not on record | 21 |
| Salamanca, ES | 21 |
| US | 21 |
| San Luis Obispo, US | 20 |
| Kew, GB | 20 |
| Provo, US | 19 |
| CICYTEXlocation not on record | 18 |
| Olocation not on record | 18 |
| Lubbock, US | 17 |
| Armidale, AU | 16 |
| Entomological Society of Latvialocation not on record | 15 |
| Los Angeles, US | 14 |
| San Isidro, AR | 14 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 14 |
| La Paz, MX | 14 |
| BAYLUlocation not on record | 13 |
| Bern, CH | 13 |
| PRClocation not on record | 13 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 13 |
| Castelar, AR | 12 |
| Natural History Museum Rotterdamlocation not on record | 12 |
| Ciudad de México, MX | 12 |
| Adam Mickiewicz University in Poznańlocation not on record | 12 |
| Görlitz, DE | 12 |
| Oskarshamn, SE | 12 |
| San Angelo, US | 12 |
| Zacatecas, MX | 12 |
| Ensenada, MX | 12 |
| Odawara, JP | 12 |
| Ciudad Autónoma de Buenos Aires, AR | 11 |
| UIBlocation not on record | 11 |
| Torreón, MX | 11 |
| Henderson, US | 11 |
| Severin-McDaniel Insect Collectionlocation not on record | 10 |
| Christchurch, NZ | 10 |
| Guasave, MX | 10 |
| UChlocation not on record | 10 |
| Edinburgh, GB | 9 |
| SLU Artdatabankenlocation not on record | 9 |
| Pamplona, ES | 9 |
| Badajoz, ES | 9 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 9 |
| Helsinki, FI | 8 |
| Phyletisches Museum Jenalocation not on record | 8 |
| Madrid, ES | 8 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 7 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 7 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 7 |
| Pamplona, ES | 7 |
| Logan, US | 7 |
| Yangling, CN | 7 |
| Cape Town, ZA | 7 |
| Paris, FR | 7 |
| Tampa, US | 7 |
| Wuzhou, CN | 7 |
| Uppsala, SE | 6 |
| Frankfurt am Main | 6 |
| Bratislava, SK | 6 |
| Chapel Hill, US | 6 |
| Hobart, AU | 6 |
| Emporia, US | 6 |
| Northridge, US | 6 |
| GJOlocation not on record | 6 |
| ESP003location not on record | 6 |
| Chapingo, MX | 6 |
| BFLlocation not on record | 6 |
| Arizona State University Biocollectionslocation not on record | 5 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 5 |
| GB | 5 |
| Long Beach, US | 5 |
| EEZA-CSIClocation not on record | 5 |
| Valparaiso, CL | 5 |
| Fullerton, US | 5 |
| Rishon Le Zion, IL | 5 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 5 |
| Beijing, CN | 5 |
| CJBNlocation not on record | 5 |
| NSW Office of Environment and Heritagelocation not on record | 5 |
| Chicago, US | 5 |
| San Bernardino, US | 5 |
| Auckland, NZ | 4 |
| Orem, US | 4 |
| Sanda, JP | 4 |
| Tomioka, JP | 4 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 4 |
| Cambridge, US | 4 |
| Chongqing Museumlocation not on record | 4 |
| Arcata, US | 4 |
| San Jose, US | 4 |
| Government College University Lahore, Dr. Sultan Ahmad Herbariumlocation not on record | 4 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 4 |
| Tsukuba, JP | 4 |
| KURAlocation not on record | 4 |
| UGentlocation not on record | 3 |
| Corrientes, AR | 3 |
| Nanjing, CN | 3 |
| Bloomington, US | 3 |
| Tilburg, NL | 3 |
| Bangkok, TH | 3 |
| Jaén, ES | 3 |
| JBSlocation not on record | 3 |
| Muséum Henri Lecoqlocation not on record | 3 |
| Pullman, US | 3 |
| BGPAlocation not on record | 3 |
| Boise, US | 3 |
| Tartu, EE | 3 |
| Vancouver, CA | 3 |
| Pocatello, US | 3 |
| John T. Waterhouse Herbariumlocation not on record | 3 |
| Instituto de Ecología, Universidad Nacional Autónoma de Méxicolocation not on record | 3 |
| J.F.Oberlin Universitylocation not on record | 3 |
| Catalina Island Conservancylocation not on record | 3 |
| Millersville, US | 3 |
| BRNUlocation not on record | 3 |
| Culiacán, MX | 2 |
| Trondheim, NO | 2 |
| OLAlocation not on record | 2 |
| Morelia, MX | 2 |
| Kawasaki Shi Tama Ku, JP | 2 |
| Angwin, US | 2 |
| Balochistan University of Information Technology, Engineering and Management Scienceslocation not on record | 2 |
| University of Stellenboschlocation not on record | 2 |
| Herbarium of South China Botanical Gardenlocation not on record | 2 |
| Hazara Universitylocation not on record | 2 |
| La Paz, BO | 2 |
| Frauenfeld, CH | 2 |
| Arizona Western Collegelocation not on record | 2 |
| Linares, MX | 2 |
| Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahualocation not on record | 2 |
| Nijmegen, NL | 2 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 2 |
| Provincia di Livornolocation not on record | 2 |
| Bergen, NO | 2 |
| Mlocation not on record | 2 |
| Brussel, BE | 2 |
| Montecillo, Texcoco, MX | 2 |
| Parkville, AU | 2 |
| Oulu, FI | 2 |
| Philadelphia, US | 2 |
| BISHlocation not on record | 1 |
| SZUlocation not on record | 1 |
| Mérida, MX | 1 |
| University of Alberta Museumslocation not on record | 1 |
| Moscow, US | 1 |
| Hunan Geological Museumlocation not on record | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| QCNElocation not on record | 1 |
| St. Paul, US | 1 |
| Bourges, FR | 1 |
| Santa Cruz, US | 1 |
| Post Graduate College Bannulocation not on record | 1 |
| Juriquilla, MX | 1 |
| Corvallis, US | 1 |
| Honolulu, US | 1 |
| Coimbra, PT | 1 |
| Servico de Microbiologia e Imunologialocation not on record | 1 |
| Sede di Via Giorgio La Pira del Museo di Storia naturale di Firenze | Via Giorgio La Pira headquarter of the Natural History Museum in Florencelocation not on record | 1 |
| Santiago de Compostela, ES | 1 |
| Pittsburg, US | 1 |
| Glocation not on record | 1 |
| PrivatHerblocation not on record | 1 |
| US | 1 |
| Minia, EG | 1 |
| DBF-NHMDlocation not on record | 1 |
| Santa Cruz de la Sierra, BO | 1 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 1 |
| Arequipa, PE | 1 |
| La Trobe Universitylocation not on record | 1 |
| Burlington, US | 1 |
| Green Bay, US | 1 |
| Córdoba, ES | 1 |
| Clemson, US | 1 |
| Lausanne, CH | 1 |
| The University of Arizonalocation not on record | 1 |
| Texas Lutheran Universitylocation not on record | 1 |
| University of Southern Mississippilocation not on record | 1 |
| Dresden, DE | 1 |
| Gijón, ES | 1 |
| Xiamen, CN | 1 |
| Fredericton Stock Culture Collectionlocation not on record | 1 |
| Berea Collegelocation not on record | 1 |
| Eastern Nevada Landscape Coalitionlocation not on record | 1 |
| San Francisco, US | 1 |
| Puebla, MX | 1 |
| USFSlocation not on record | 1 |
| Columbia, US | 1 |
| Stephenville, US | 1 |
| Boumlocation not on record | 1 |
| Turlock, US | 1 |
| Altai State Universitylocation not on record | 1 |
| Universidad Nacional Mayor de San Marcos, Museo de Historia Naturallocation not on record | 1 |
| TROMlocation not on record | 1 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 1 |
| IPA/SPlocation not on record | 1 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 1 |
| Dekalb, US | 1 |
| National Institute of Biological Resourceslocation not on record | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| BSBIlocation not on record | 1 |
| Salta, AR | 1 |
| Mendoza, AR | 1 |
| NMBU:MINAlocation not on record | 1 |
| Guangzhou, CN | 1 |
| MHNAIXlocation not on record | 1 |
| Wuhan, CN | 1 |
| Wellington, NZ | 1 |
| GAlocation not on record | 1 |
| ISAlocation not on record | 1 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 1 |
| Salzburg, AT | 1 |
| New Mexico Museum of Natural History and Sciencelocation not on record | 1 |
| Ann Arbor, US | 1 |
| Chiba, JP | 1 |
| MMHNSRlocation not on record | 1 |
| Sagamihara, JP | 1 |
266 institutions · 5 007 of 5 211 vouchered records shown · 204 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA21 detections
Where the DNA of Sisymbrium irio was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found21
Studies independent surveys2
Countries5
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 21 detections have coordinates
Open the map5 countries0
Brassica tournefortii, Larrea tridentata, Ma…On the hillside
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.0 °C 11.2–21.9
Seasonal swing summer↔winter21.5 °C
Max temp (day)20.2 °C 15.1–26.6
Min temp (night)9.60 °C 4.90–15.2
Precipitation35.6 mm/mo 7.60–47.0
Air humidity48.5 % 41.2–52.1
Moisture balance-97.4 mm/mo
Vapour deficit951 Pa 531–1,368
Wind speed3.20 m/s
Cloud cover43.2 % 35.7–58.4
CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.