Sisymbrium altissimum
speciesAt a glance
Occurrence records39 130
Data sources14
Biological traits59
DNA specimens35
eDNA detections22
Sources14 archives
Databases and archives Sisymbrium altissimum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility39 130 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics35 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources59 traits
Chemical compositionLOTUS1 compounds
Occurrence & distributionGBIF39 130 records
Environmental DNA1 datasets · 5 countries22 detections
DNA & barcodingBOLD · NCBI35 specimens
Genome at a glanceCCDB · GIFT · GoaT284 Mbp
01Narrative
Sisymbrium altissimum, qui a pour nom commun Sisymbre élevé ou Sisymbre fausse moutarde, est une espèce de plante de la famille des Brassicaceae et du genre Sisymbrium.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology22
Fruit length75 mm
⚠ sources differ — AusTraits: 75 mm · GIFT: 90 mm
Fruit length max100 mm
Fruit length min50 mm
Fruit width1.25 mm
⚠ sources differ — AusTraits: 1.25 mm · GIFT: 1 mm
Leaf length100 mm
⚠ sources differ — AusTraits: 100 mm · GIFT: 120 mm
Leaf length max160 mm
Leaf length min80 mm
Leaf mass212 mg
Leaf size4 746 mm²
⚠ sources differ — LEDA: 4 746 mm² · GIFT: 6 619 mm²
Leaf width50 mm
Leaf width max6 mm
Leaf width min3 mm
Plant height0.523 m
⚠ sources differ — GIFT: 0.523 m · AusTraits: 1 m · LEDA: 0.487 m · TRY: 0.742 m
Plant height generative0.6 m
Plant height max1.5 m
Plant height min0.2 m
Seed length1.08 mm
⚠ sources differ — TRY: 1.08 mm · GIFT: 0.8 mm
Seed length max1 mm
Seed length min0.8 mm
Seed mass0.192 mg
⚠ sources differ — TRY: 0.192 mg · LEDA: 0.231 mg · GIFT: 0.204 mg
Seed mass max0.25 mg
Seed mass min0.131 mg
Life cycle & reproduction15
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: evergreen
Dehiscencedehiscent
Dispersal typehuman
⚠ sources differ — LEDA: agochor · GIFT: anemochorous
Flower colouryellow
Flowering endJul
Flowering startMay
Life formannual
Life spanannual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
⚠ sources differ — LEDA: Hemicryptophyte · GIFT: therophyte
Reproduction asexualabsent
Seed number496 104
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 500 m
Elevation mean2 600 m
Elevation min0 m
Epiphyteterrestrial
Fruit typesilique
⚠ sources differ — AusTraits: silique · GIFT: capsule
Growth formherb
Habitat GIFTcrop fields, old fields, roadsides
Leaf compoundnesssimple
Leaf shapelinear
Mycorrhiza type0.000152557
Woodinessnon-woody
Physiology & chemistry4
Leaf dry-matter content (LDMC)124 mg/g
⚠ sources differ — TRY: 124 mg/g · LEDA: 132 mg/g
Photosynthetic pathwayC3
Seed longevity index1
Specific leaf area (SLA)20.78 mm²/mg
⚠ sources differ — TRY: 20.78 mm²/mg · LEDA: 21.98 mm²/mg · GIFT: 21.19 mm²/mg
Other traits2
Diaspore typeone-seeded generative dispersule
Monocarpymonocarp
03Chemical composition1 compounds
Compounds documented for Sisymbrium altissimum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile1 class
Glucosinolates1
Documented compounds1 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| [(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl] (1E)-2-methyl-N-sulfooxypropanimidothioate | present | LOTUS |
05DNA & barcoding35 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sisymbrium altissimum has left across the world's sequence archives.
At a glance
DNA specimens35
Marker genes6
GenBank sequences10
eDNA detections22
Countries6
The DNA barcodea real sequence read deposited for this species
ATCATCACTATCGGTGGGCCGGTTTCTTAACTGATCCCGTTTCCACCGATTCCGTGGCTTTGCGTATGGTCCCAATCTCGGTTGGATCAT …
Sisymbrium altissimum isolate TLF-193 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK2★rbcL6★rbcLa★ITS2★ITS2
animal barcodeplant barcodefungal barcode
06Genome at a glanceCCDB · GIFT · GoaT · NCBI
The complete instruction manual Sisymbrium altissimum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size283 620 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Sisymbrium altissimum0.28 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 14 n = 7
Ploidy2× diploid · measured
Chromosome records14–142n range14median14mode43records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1443×GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl · CCDB · iber-fl +12
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1974a: Index of chromosome numbers of Slovakian flora (Part 3). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 22: 1-20.
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. IX. Cruciferae Queirs, M.Bol. Soc. Brot. ser. 247: 315-335(1973).
CCDB · iber-fl — Nmeros cromossmicos para a flora portuguesa, 116-127. Queirs, M.Bol. Soc. Brot. ser. 266: 117-124(1993).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2267
CCDB · fl-europaea — Lovkvist, 1963
CCDB · ipcn-api-dl — Carrique, M. C. & A. J. Martínez. 1984. Números de cromosómas de Cruciferae 1. Parodiana 3: 113–128.
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Ancev, M. E. 1978b. In IOPB chromosome number reports LXII. Taxon 27: 519–535.
CCDB · ipcn-api-dl — Dvorak, F. & B. Dadakova. 1975a. In IOPB chromosome number reports XLIX. Taxon 24: 501–516.
CCDB · book-ipcn75-78 — Dvorak & Dadakova 1975a
CCDB · book-ipcn75-78 — Ancev 1978
CCDB · book-ipcn73-74 — QUEIROS, M. 1973. Contribuicao para o conhecimento citotaxonomico d~ Spermatophyta de Portugal. IX. Cruciferae. Bol. Soc. Brot. 47(Ser. 2 315 335. I
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian flora. (Part 3). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 22: 1-20.
CCDB · eflora
CCDB · book-fedorov — Manton 1932
CCDB · book-fedorov — Smith F. II. 1938
CCDB · book-fedorov — II eiser, Whitaker 1948
CCDB · brass — Carrique & Martnez
CCDB · brass — Ancev
CCDB · brass — Mulligan
CCDB · brass — Mjovsky et al.
CCDB · brass — Dvork & Dadkov
CCDB · brass — Javurkov-Jarolimov
CCDB · brass — Manton
CCDB · brass — Lve & Lve
CCDB · brass — Queirs
CCDB · brass — Lvkvist & Hultgrd
CCDB · brass — Heiser & Whitaker
CCDB · book-atlas-flowering-plants — F. H. Smith 1938
CCDB · Cave1956 — Love & Love b
CCDB · CromoCat 2015 — Ancev, M. E. (1978a). Karyological study of Bulgarian Campanulaceae. Fitologija 5: 66-74.
CCDB · CromoCat 2015 — Ancev, M. E. (1978c). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXII]. Taxon 27(5/6): 532-533.
CCDB · CromoCat 2015 — Carrique, M. C. & Martínez, A. J. (1984). Números de cromosomas de Cruciferae 1. Parodiana 3: 113-128.
CCDB · CromoCat 2015 — Danihelka, J. & Rotreklová, O. (2001a). Chromosome numbers within the Achillea millefolium and the A. distans groups in the Czech Republic and Slovakia. Folia Geobot., Praha 36: 163-191
CCDB · CromoCat 2015 — Dvorak, F. & Dadakova, B. (1975a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLIX]. Taxon 24(4): 508-509.
CCDB · CromoCat 2015 — Lövkvist, B. & Hultgård, U.-M. (1999). Chromosome numbers in south Swedish vascular plants Opera botanica 137: 1-42
CCDB · CromoCat 2015 — M?sí?ek J. et Jarolímová-Jav?rková V. (1992). List of chromosome numbers of the Czech vascular plants. Academia, Praha. p. 1-144.
CCDB · CromoCat 2015 — Queirós, M. (1973c). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. IX. Cruciferae. Bol. Soc. Brot. 47: 315-335.
+1 more references
2n 1953×CCDB · book-fedorov
CCDB · book-fedorov — Gb
CCDB · book-fedorov — Mulligan 1961a
CCDB · book-fedorov — Easterly 1963
n 722×CCDB · ipcn-api-dl · CCDB · book-ipcn66 · CCDB · book-ipcn67-71 +3
CCDB · ipcn-api-dl — Ward, D. E. 1983. Chromosome counts from New Mexico and southern Colorado. Phytologia 54: 302–309.
CCDB · ipcn-api-dl — Mulligan, G. A. 1984. Chromosome numbers of some plants native and naturalized in Canada. Naturaliste Canad. 111: 447–449.
CCDB · ipcn-api-dl — Khatoon, S. & S. I. Ali. 1993. Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi.
CCDB · ipcn-api-dl — Rollins, R. C. & L. RUDENBERG. 1977. Chromosome numbers of Cruciferae III. Contr. Gray Herb. 207: 101–116.
CCDB · ipcn-api-dl — Maassoumi, A. A. R. 1980. Cruciferes de la flore d'lran. Etude Caryosystematique. Thesis, Strasbourg, 1980. 1–83.
CCDB · book-ipcn66 — Rollins1966
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · brass — Taylor & Mulligan
CCDB · brass — Mulligan
CCDB · brass — Maassoumi
CCDB · brass — Khatoon & Ali
CCDB · brass — Smith
CCDB · brass — Easterly
CCDB · brass — Rollins
CCDB · brass — Rollins & Rdenberg
CCDB · brass — Ward
CCDB · Cave1963 — Easterly 1963
CCDB · CromoCat 2015 — Khatoon, S. & Ali, S. I. (1993). Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi
CCDB · CromoCat 2015 — Maassoumi, A. (1980). Crucifères de la flore d'Iran. Etude caryosystématique. Tesis Strasbourg
CCDB · CromoCat 2015 — Mulligan, G. A. (1984). Chromosome numbers of some plants native and naturalized in Canada. Naturaliste Canad. 111: 447-449.
CCDB · CromoCat 2015 — Rollins, R. C. & L. Rudenberg (1977). Chromosome numbers of Cruciferae III Contr. Gray Herb. 207: 101–116.
CCDB · CromoCat 2015 — Ward, D. E. (1983b). Chromosome counts from New Mexico and southern Colorado Phytologia 54: 302–309
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid2×GoaT · Kew Plant DNA C-values Database · GIFT · GIFT (floras)
GoaT · Kew Plant DNA C-values Database
GIFT · GIFT (floras)
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelScaffold
Completeness98% BUSCO
08Occurrence & distribution
Record type39 130 records
Wild obs. + sensor28 889
Museum / vouchered10 175
Other66
Origin
Native11
Introduced2 034
Range
Area of Occupancy AOO75 700 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy51% within 1 km
≤100 m 7 580≤1 km 5 754≤10 km 12 291>10 km 368
25 993 georeferenced · 2 896 without coordinates
Open the mapobservation + sensor28 889
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy43% within 1 km
≤100 m 706≤1 km 1 829≤10 km 2 309>10 km 1 018
5 862 georeferenced · 4 313 without coordinates
Open the institutions mapphysical evidence10 175
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions196 of 317 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Helsinki, FI | 683 |
| LDlocation not on record | 347 |
| Uniwersytet Wrocławskilocation not on record | 343 |
| Olocation not on record | 338 |
| Wuzhou, CN | 299 |
| Moscow State Universitylocation not on record | 270 |
| Claremont, US | 246 |
| MeiseBGlocation not on record | 231 |
| DAOlocation not on record | 224 |
| San Diego, US | 182 |
| Riverside, US | 166 |
| Pullman, US | 144 |
| Uniwersytet Warszawskilocation not on record | 134 |
| Philadelphia, US | 132 |
| Oulu, FI | 123 |
| Madison, US | 119 |
| Moscow, US | 116 |
| Oskarshamn, SE | 115 |
| Bronx, US | 113 |
| WTUlocation not on record | 111 |
| Bergen, NO | 109 |
| St. Paul, US | 108 |
| Flagstaff, US | 100 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 98 |
| Berlin, DE | 97 |
| Denver, US | 96 |
| Chadron, US | 94 |
| Victoria, CA | 93 |
| SLU Artdatabankenlocation not on record | 83 |
| Chongqing Museumlocation not on record | 81 |
| Trondheim, NO | 79 |
| Santa Barbara, US | 79 |
| ASUlocation not on record | 76 |
| Albuquerque, US | 76 |
| Tartu, EE | 74 |
| Corvallis, US | 73 |
| Kuopio, FI | 72 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 65 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 64 |
| BFLlocation not on record | 62 |
| Boise, US | 62 |
| Missoula, US | 60 |
| Brussel, BE | 60 |
| Québec, CA | 60 |
| Vancouver, CA | 59 |
| Adam Mickiewicz University in Poznańlocation not on record | 58 |
| Phoenix, US | 58 |
| TUR-Alocation not on record | 57 |
| Ann Arbor, US | 55 |
| KMNlocation not on record | 54 |
| Görlitz, DE | 54 |
| Bloomington, US | 52 |
| Allentown, US | 51 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 50 |
| Davis, US | 48 |
| Turku, FI | 45 |
| Burlington, US | 44 |
| Bozeman, US | 43 |
| Canadian Department of Agriculturelocation not on record | 41 |
| South Kensington, GB | 40 |
| DOI/NPS, Greenbelt Parklocation not on record | 39 |
| Bern, CH | 39 |
| Spearfish, US | 36 |
| Pocatello, US | 35 |
| University of New Hampshirelocation not on record | 34 |
| New Haven, US | 34 |
| KIRMlocation not on record | 34 |
| University of Alberta Museumslocation not on record | 32 |
| Logan, US | 31 |
| Provo, US | 31 |
| BRNUlocation not on record | 31 |
| Caldwell, US | 30 |
| Uppsala, SE | 30 |
| Salzburg, AT | 28 |
| CASlocation not on record | 27 |
| Jyväskylä, FI | 27 |
| Acadia Universitylocation not on record | 27 |
| San Luis Obispo, US | 27 |
| Saint Louis, US | 27 |
| GMBAlocation not on record | 26 |
| Tallinn, EE | 23 |
| Université Lavallocation not on record | 23 |
| Mlocation not on record | 23 |
| Arcata, US | 22 |
| Wlocation not on record | 22 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 20 |
| Christchurch, NZ | 20 |
| Cheney, US | 20 |
| DBF-NHMDlocation not on record | 19 |
| Zürich, CH | 19 |
| Los Angeles, US | 18 |
| San Isidro, AR | 18 |
| Tampa, US | 17 |
| Mexico City, MX | 17 |
| Toronto, CA | 16 |
| Chiba, JP | 16 |
| Saint John, CA | 15 |
| Henderson, US | 15 |
| Chapel Hill, US | 15 |
| Durango, US | 15 |
| Grand Junction, US | 14 |
| Brookings, US | 14 |
| Lincoln, US | 14 |
| Severin-McDaniel Insect Collectionlocation not on record | 14 |
| Davenport, US | 13 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 13 |
| Pittsburg, US | 13 |
| Emporia, US | 13 |
| Staten Island, US | 13 |
| Green Bay, US | 13 |
| Natural History Museum Rotterdamlocation not on record | 13 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 12 |
| EL PASO, US | 12 |
| UChlocation not on record | 11 |
| Provincia di Livornolocation not on record | 11 |
| Dekalb, US | 11 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 11 |
| Uniwersytet Jagiellońskilocation not on record | 11 |
| Eastern Nevada Landscape Coalitionlocation not on record | 11 |
| Montréal, CA | 11 |
| Orem, US | 11 |
| Tacoma, US | 11 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 11 |
| Frauenfeld, CH | 10 |
| TROMlocation not on record | 10 |
| Bangkok, TH | 10 |
| WINlocation not on record | 10 |
| University of Stellenboschlocation not on record | 10 |
| Fort Worth, US | 10 |
| Zürich, CH | 10 |
| IDElocation not on record | 10 |
| Angwin, US | 10 |
| US | 9 |
| McWane Science Centerlocation not on record | 9 |
| Wellington, NZ | 9 |
| Tomioka, JP | 9 |
| Irvine, US | 9 |
| Beijing, CN | 8 |
| Garðabær, IS | 8 |
| Ciudad Autónoma de Buenos Aires, AR | 8 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 8 |
| Northridge, US | 8 |
| Tilburg, NL | 7 |
| Porvoo, FI | 7 |
| Bandelier National Monumentlocation not on record | 7 |
| US | 7 |
| Museo Entomologico de Leonlocation not on record | 7 |
| BAYLUlocation not on record | 7 |
| Osaka, JP | 7 |
| BClocation not on record | 6 |
| Shinshu Universitylocation not on record | 6 |
| Rocky Mountain Biological Laboratorylocation not on record | 6 |
| Nanjing, CN | 6 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 6 |
| Castelar, AR | 6 |
| NMBU:MINAlocation not on record | 6 |
| Fullerton, US | 6 |
| Austin, US | 6 |
| Forssa, FI | 6 |
| San Francisco, US | 5 |
| Fredericton Stock Culture Collectionlocation not on record | 5 |
| Nagano City, JP | 5 |
| Weber State Universitylocation not on record | 5 |
| Waverly, US | 5 |
| Mexico City, MX | 5 |
| PRClocation not on record | 5 |
| Walla Walla, US | 5 |
| Tempe, US | 5 |
| Portland, US | 5 |
| Odawara, JP | 5 |
| Museum of the Rockieslocation not on record | 5 |
| 4 | |
| GJOlocation not on record | 4 |
| Toyama, JP | 4 |
| Salamanca, ES | 4 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 4 |
| BISHlocation not on record | 4 |
| Long Beach, US | 4 |
| John May Museum of Natural Historylocation not on record | 4 |
| Bend, US | 4 |
| QAUlocation not on record | 4 |
| Ashland, US | 4 |
| Frankfurt am Main | 4 |
| Mount Annan, AU | 4 |
| Canberra, AU | 4 |
| MAlocation not on record | 4 |
| University of Lethbridgelocation not on record | 4 |
| Montecillo, Texcoco, MX | 4 |
| Kushiro City Museumlocation not on record | 4 |
| Columbia, US | 4 |
| DOI/NPS, San Juan Island National Historical Parklocation not on record | 4 |
| USFSlocation not on record | 4 |
| Otaru, JP | 4 |
| Entomological Society of Latvialocation not on record | 4 |
| Whitewater, US | 4 |
| Auckland, NZ | 4 |
| Durango, MX | 4 |
| College Park, US | 4 |
| BIO-UNIPIlocation not on record | 4 |
| Xiamen, CN | 4 |
| Tsukuba, JP | 4 |
| Keene State Universitylocation not on record | 3 |
| Whitehorse, CA | 3 |
| Tokushima, JP | 3 |
| BGBMlocation not on record | 3 |
| Xining, CN | 3 |
| Lubbock, US | 3 |
| Chicago, US | 3 |
| Uniwersytet Opolskilocation not on record | 3 |
| JP | 3 |
| CJBNlocation not on record | 3 |
| Glarus, CH | 3 |
| Fulda, DE | 3 |
| SEFlocation not on record | 3 |
| Philadelphia, US | 3 |
| Chicago, US | 3 |
| KURAlocation not on record | 3 |
| SZUlocation not on record | 2 |
| BSBIlocation not on record | 2 |
| Chicago, US | 2 |
| Culiacán, MX | 2 |
| Barcelona, ES | 2 |
| Urumqi, CN | 2 |
| H-Schuhwlocation not on record | 2 |
| Minia, EG | 2 |
| Millersville, US | 2 |
| Macomb, US | 2 |
| Williamsburg, US | 2 |
| SIHUlocation not on record | 2 |
| Kunming, CN | 2 |
| Turlock, US | 2 |
| VALElocation not on record | 2 |
| GB | 2 |
| Santiago de Compostela, ES | 2 |
| Namur, BE | 2 |
| Knoxville, US | 2 |
| Kawasaki Shi Tama Ku, JP | 2 |
| San Jose, US | 2 |
| Göteborg, SE | 2 |
| Paris, FR | 2 |
| Nijmegen, NL | 2 |
| INFlocation not on record | 2 |
| Córdoba, AR | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| University of Southern Mississippilocation not on record | 2 |
| Dresden, DE | 2 |
| University of British Columbia, Herbariumlocation not on record | 2 |
| Philadelphia, US | 2 |
| Pacific Lutheran Universitylocation not on record | 2 |
| Bureau of Land Managementlocation not on record | 2 |
| DOI/NPS, Craters of the Moon National Monument & Preservelocation not on record | 1 |
| Sanda, JP | 1 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 1 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 1 |
| Juriquilla, MX | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| Anchorage, US | 1 |
| Lausanne, CH | 1 |
| Hamilton, US | 1 |
| College of the Atlantic, Museumlocation not on record | 1 |
| Truckee, US | 1 |
| Honolulu, US | 1 |
| Taipei, TW | 1 |
| Stockholm, SE | 1 |
| Norfolk, US | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| Yukon Universitylocation not on record | 1 |
| US | 1 |
| Pomona Collegelocation not on record | 1 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 1 |
| Badajoz, ES | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| Stephenville, US | 1 |
| Bratislava, SK | 1 |
| West Virginia Wesleyan Collegelocation not on record | 1 |
| Royal Botanical Gardenslocation not on record | 1 |
| H-AkrKGlocation not on record | 1 |
| Torreón, MX | 1 |
| BDBClocation not on record | 1 |
| IWEP FEB RASlocation not on record | 1 |
| Wuhan, CN | 1 |
| San Bernardino, US | 1 |
| Sagamihara, JP | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Fribourg, CH | 1 |
| Arizona Western Collegelocation not on record | 1 |
| Sion, CH | 1 |
| Hudson, US | 1 |
| Hobart, AU | 1 |
| Rotorua, NZ | 1 |
| Herb. BBGlocation not on record | 1 |
| La Paz, MX | 1 |
| Oswego, US | 1 |
| San Angelo, US | 1 |
| San Diego Natural History Museumlocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Edmonton, CA | 1 |
| Karlsruhe, DE | 1 |
| Jackson, US | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| Western Carolina Universitylocation not on record | 1 |
| Omachi Alpine Museumlocation not on record | 1 |
| Uberlândia, BR | 1 |
| New Mexico Museum of Natural History and Sciencelocation not on record | 1 |
| Ural Federal University "B. N. Yeltsin"location not on record | 1 |
| Elikins, US | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| Denton, US | 1 |
| Bourges, FR | 1 |
| Calabar, NG | 1 |
| Ciudad de México, MX | 1 |
| National Institute of Biological Resourceslocation not on record | 1 |
| Clemson, US | 1 |
| BG-NMNHSlocation not on record | 1 |
| Obihiro Centennial City Museumlocation not on record | 1 |
| USFS/BHSClocation not on record | 1 |
317 institutions · 9 090 of 10 175 vouchered records shown · 1 013 without an institution code
09Environmental DNA22 detections
Where the DNA of Sisymbrium altissimum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found22
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 22 detections have coordinates
Open the map5 countries0
compost area for grass waste from golf courseRiparian with Salix laevigata, Salix exigua,…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.8 °C 11.0–17.3
Seasonal swing summer↔winter15.6 °C
Max temp (day)20.3 °C 14.9–22.2
Min temp (night)9.90 °C 7.20–14.6
Precipitation70.0 mm/mo 8.20–104
Air humidity59.7 % 51.2–62.9
Moisture balance-48.2 mm/mo
Vapour deficit742 Pa 567–852
Wind speed2.70 m/s
Cloud cover38.6 % 25.8–46.6
CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.