Sirobasidium brefeldianum

Möller · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Tremellomycetes/Tremellales/Sirobasidiaceae/Sirobasidium

At a glance

Occurrence records196

Data sources7

Biological traits0

DNA specimens1

eDNA detections52

Sources7 archives

Databases and archives Sirobasidium brefeldianum's data was compiled from.

GBIFGlobal Biodiversity Information Facility196 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI52 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF196 records

Environmental DNA5 datasets · 5 countries52 detections

DNA & barcodingBOLD · NCBI1 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sirobasidium brefeldianum has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences3

eDNA detections52

Countries5

The DNA barcodea real sequence read deposited for this species

ITSPQ527851.1 ↗356 bpIndia · 2024

ACGT

GCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCTT …

Sirobasidium brefeldianum isolate SF_Bin153 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3

fungal barcode

08Occurrence & distribution

Record type196 records

Wild obs. + sensor114

Museum / vouchered82

Origin

Native1

Range

Area of Occupancy AOO344 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 31≤1 km 8≤10 km 15

54 georeferenced · 60 without coordinates

Open the mapobservation + sensor114

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 1≤1 km 6≤10 km 12

19 georeferenced · 63 without coordinates

Open the institutions mapphysical evidence82

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	9
Kew, GB	9
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	4
Bernard Price Institute for Palaeontological Researchlocation not on record	3
Karlsruhe, DE	2
Leicester, GB	2
Vancouver, CA	1
Mlocation not on record	1
Gijón, ES	1
TENN-Flocation not on record	1
MeiseBGlocation not on record	1
Baton Rouge, US	1
Adelaide, AU	1
Copenhagen, DK	1

14 institutions · 37 of 82 vouchered records shown · 45 without an institution code

09Environmental DNA52 detections

Where the DNA of Sirobasidium brefeldianum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found52

Studies independent surveys5

Countries5

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 52 detections have coordinates

Open the map5 countries0

Neotropic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature16.6 °C 12.2–20.2

pH5.50 4.20–6.40

Conductivity48.2 µS/cm 10.0–226

Organic carbon1.89 % 0.004–5.66

Water content11.3 % 3.72–82.9

Nitrate-N6.88 mg/kg 1.00–71.0

Phosphorus4.00 mg/kg 2.00–284

Clay14.4 % 2.91–49.0

Sand71.0 % 24.4–93.1

Depth0 m 0–0.2

SoilTenosolsChromosolsSodosolLatLon out of rangeKandosolFerrosol

43 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.7 °C 12.2–21.6

Seasonal swing summer↔winter10.9 °C

Max temp (day)19.2 °C 16.8–24.9

Min temp (night)10.8 °C 8.00–18.5

Precipitation72.5 mm/mo 49.0–147

Air humidity59.7 % 55.9–62.5

Moisture balance-24.5 mm/mo -33.7–38.8

Vapour deficit735 Pa 574–965

Wind speed2.90 m/s 2.40–3.10

Cloud cover17.3 % 7.60–31.3

CHELSA 1981–2010, ~9 km grid, at location & month of 50 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)