Siraitia grosvenorii

(Swingle) C.Jeffrey ex A.M.Lu & Zhi Y.Zhang · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Cucurbitales/Cucurbitaceae/Siraitia

At a glance

Occurrence records134

Data sources13

Biological traits4

DNA specimens13

eDNA detections13

Sources13 archives

Databases and archives Siraitia grosvenorii's data was compiled from.

WikipediaWikimedia Foundation14 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility134 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources4 traits

Chemical compositionLOTUS · NPASS81 compounds

Occurrence & distributionGBIF134 records

Environmental DNA1 datasets · 1 countries13 detections

DNA & barcodingBOLD · NCBI13 specimens

Genome at a glanceCCDB2n = 28

01Narrative

Siraitia grosvenorii, also known as monkfruit or luohan guo, is a herbaceous perennial vine of the gourd family, Cucurbitaceae. It is native to southern China. The plant is cultivated for its fruit extract, called mogrosides, which creates a sweetness sensation 250 times stronger than sucrose. Mogroside extract has been used as a low-calorie sweetener for drinks and in traditional Chinese medicine. The scientific species name honors Gilbert Hovey Grosvenor, who, as president of the National Geographic Society, helped to fund an expedition in the 1930s to find the living plant in China where it was already being cultivated.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction1

Life formclimbing tuberous geophyte

Habitat & environment3

Climatesubtropical

Growth formclimber

Woodinessvariable

03Chemical composition81 compounds

Compounds documented for Siraitia grosvenorii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking

Compound class profile5 classes

Cucurbitane triterpenoids31

Monosaccharides10

Wax monoesters4

Disaccharides $ Flavones $ Monosaccharides $ Polysaccharides3

Flavonols2

Documented compounds81 total

Tissue Source Quantified only

Compound	Amount	Source
(2R,3R,4S,5S)-2,3,4,5-tetrahydroxyhexanal	present	LOTUS
(2R,3R,4S,5S,6R)-2-[[(2R,3S,4S,5R,6R)-6-[[(3S,8R,9R,10R,11R,13R,14S,17R)-17-[(2R,5R)-5-[(2S,3R,4S,5S,6R)-4,5-dihydroxy-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-6-[[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]oxan-2-yl]oxy-6-hydroxy-6-methylheptan-2-yl]-11-hydroxy-4,4,9,13,14-pentamethyl-2,3,7,8,10,11,12,15,16,17-decahydro-1H-cyclopenta[a]phenanthren-3-yl]oxy]-3,4-dihydroxy-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]methoxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
(2R,3S,4R,5R)-2,3,4,5,6-pentahydroxyhexanal	present	LOTUS
(2R,3S,4S,5R)-2,3,4,5,6-pentahydroxyhexanal	present	LOTUS
(2S,3S,4S,5R)-2,3,4,5-tetrahydroxy-6-oxohexanoic acid	present	LOTUS
(3beta,13alpha,14beta)-13-Methyl-26-norolean-8-en-3-ol	present	LOTUS
(3S,8S,9S,10S,13R,14S,17R)-17-[(2R,5R)-5-[(2S,3R,4S,5S,6R)-4,5-dihydroxy-3-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-6-[[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]oxan-2-yl]oxy-6-hydroxy-6-methylheptan-2-yl]-4,4,9,13,14-pentamethyl-3-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-[[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]oxan-2-yl]oxy-1,2,3,7,8,10,12,15,16,17-decahydrocyclopenta[a]phenanthren-11-one	present	LOTUS
(6R,9R)-3-Oxo-Alpha-Ionol-Beta-D-Glucopyranoside	present	NPASS
(6R,9S)-3-Oxo-alpha-ionol glucoside	present	NPASS
(E)-4-[(1R,4R)-2,6,6-trimethyl-4-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxycyclohex-2-en-1-yl]but-3-en-2-one	present	NPASS

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Siraitia grosvenorii has left across the world's sequence archives.

At a glance

DNA specimens13

Marker genes4

GenBank sequences10

eDNA detections13

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLDQ535850.1 ↗1 385 bp

ACGT

ATAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCGGGAGTTCCGC …

Siraitia grosvenorii voucher Cao Ming s.n., Guangxi Botanical Garden, Aug. 2004 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL7★ITS★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Siraitia grosvenorii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidypolyploid inferred

Chromosome records28–282n range28median28mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 282×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Wang, S. m. 1987. Observations on the chromosome number of Siraitia grosvenori in China. Acta Phytotax. Sin. 25: 105.

CCDB · ipcn-api-dl — Li, J. q., Z. y. Wu & A. m. Lu. 1993. Cytological observation on the plants of Thladianthinae (Cucurbitaceae). Acta Bot. Yunnan. 15: 101–104.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type134 records

Wild obs. + sensor2

Museum / vouchered132

Range

Area of Occupancy AOO240 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 1 without coordinates

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 132 records without

Open the institutions mapphysical evidence132

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Guilin, CN	66
Guangzhou, CN	20
Beijing, CN	19
Kunming, CN	7
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	6
Wuhan, CN	4
Saint Louis, US	2
Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record	2
Jiujiang Forestry Institutelocation not on record	1
Chengdu, CN	1
Fujian Institute of Subtropical Botanylocation not on record	1

11 institutions · 129 of 132 vouchered records shown · 2 without an institution code

09Environmental DNA13 detections

Where the DNA of Siraitia grosvenorii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.0 °C 10.0–10.0

Seasonal swing summer↔winter31.5 °C

Max temp (day)15.7 °C

Min temp (night)3.10 °C

Precipitation13.8 mm/mo

Air humidity45.7 %

Moisture balance-95.2 mm/mo

Vapour deficit827 Pa

Wind speed4.50 m/s

Cloud cover24.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)