Siphonodon celastrineus

Griff. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Celastrales/Celastraceae/Siphonodon

At a glance

Occurrence records303

Data sources10

Biological traits13

DNA specimens5

eDNA detections5

Sources10 archives

Databases and archives Siphonodon celastrineus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility303 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF303 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 28

01Narrative

Siphonodon celastrineus is a species of plant in the family Celastraceae. It is found in Cambodia, India, Myanmar, and Vietnam.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height max35 m

Life cycle & reproduction3

Deciduousnessevergreen

Life formtree

Life spanperennial

Habitat & environment4

Climatewet tropical

Climberself-supporting

Growth formtree

Woodinesswoody

Physiology & chemistry5

Leaf n23.2 mg/g

Leaf p1.8 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)9.5 mm²/mg

Wood density617 mg/cm³

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Siphonodon celastrineus has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes3

GenBank sequences7

eDNA detections5

The DNA barcodea real sequence read deposited for this species

ITSAY935886.1 ↗253 bp

ACGT

TCGAAACCTGGCAGAACGACCCGCGAACCGTTCAAAACCNCCATGGGCGACGGGCCTCTCGGTCGGTCGCCTGACGGCTGCGGAGAGCGG …

Siphonodon celastrineus isolate 23 internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL1★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Siphonodon celastrineus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 281×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Oginuma, K., K. Damas & H. Tobe. 1999. A cytology of some plants from Papua New Guinea: additional notes. Acta Phytotax. Geobot. 50: 43–50.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type303 records

Wild obs. + sensor10

Museum / vouchered281

Other12

Origin

Native6

Range

Area of Occupancy AOO704 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 10 records without

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤1 km 10≤10 km 11

21 georeferenced · 260 without coordinates

Open the institutions mapphysical evidence281

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	9
Canberra, AU	7
Mount Annan, AU	6
Kew, GB	6
Honolulu, US	5
Smithfield, AU	4
Edinburgh, GB	3
Fort Worth, US	3
Paris, FR	2
Xiamen, CN	2
Saint Louis, US	2
National Institute of Biological Resourceslocation not on record	1
Cambridge, US	1
Bronx, US	1
Guangzhou, CN	1
Wlocation not on record	1
Monastir, TN	1
St. Paul, US	1

18 institutions · 56 of 281 vouchered records shown · 225 without an institution code

09Environmental DNA5 detections

Where the DNA of Siphonodon celastrineus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)