Siphonodon australis

Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Celastrales/Celastraceae/Siphonodon

At a glance

Occurrence records670

Data sources5

Biological traits36

DNA specimens6

eDNA detections5

Sources5 archives

Databases and archives Siphonodon australis's data was compiled from.

GBIFGlobal Biodiversity Information Facility670 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources36 traits

Occurrence & distributionGBIF670 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI6 specimens

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology16

Fruit length35 mm

Fruit width35 mm

Leaf length82.5 mm

Leaf length max130 mm

Leaf length min45 mm

Leaf mass per area122 g/m2

Leaf size2 214 mm²

Leaf width25 mm

Leaf width max60 mm

Leaf width min25 mm

Petiole length0.8 cm

Plant height30 m

Plant height max30 m

Seed length15 mm

Seed mass68.74 mg

Seed width6.5 mm

Life cycle & reproduction6

Flowering endFeb

Flowering startJan

Flowering timeyynnnnnnnnyy

Life formtree

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typedrupe

Growth formtree

Leaf compoundnesssimple

Leaf shapeelliptical oblong obovate

Woodinesswoody

Physiology & chemistry2

Specific leaf area (SLA)8.61 mm²/mg

Wood density688 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Siphonodon australis has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes4

GenBank sequences6

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSJF409987.1 ↗692 bp

ACGT

TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGGCAGAACGACCCGTGAACCGTTGGAAATCACCACGGGCGACGGGCCTC …

Siphonodon australis voucher Sydney Botanical Garden, no acc. # 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 28S ribosomal RNA gene, region

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3★ITS1trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type670 records

Wild obs. + sensor192

Museum / vouchered245

Cultivated / captive2

Other231

Origin

Native17

Range

Area of Occupancy AOO1 840 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 120≤1 km 7≤10 km 9>10 km 2

138 georeferenced · 54 without coordinates

Open the mapobservation + sensor192

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 46≤1 km 29≤10 km 107>10 km 28

210 georeferenced · 35 without coordinates

Open the institutions mapphysical evidence245

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 1 without coordinates

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	103
Smithfield, AU	53
Museo Entomologico de Leonlocation not on record	29
Mount Annan, AU	16
Canberra, AU	13
Armidale, AU	10
Palmerston, AU	6
James Cook Townsvillelocation not on record	2
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
Wellington, NZ	1
Kew, GB	1
Hobart, AU	1
ASUlocation not on record	1

13 institutions · 237 of 245 vouchered records shown · 8 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Siphonodon australis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.0 °C 16.0–16.0

Seasonal swing summer↔winter11.9 °C

Max temp (day)21.5 °C

Min temp (night)11.1 °C

Precipitation67.7 mm/mo

Air humidity58.5 %

Moisture balance-38.4 mm/mo

Vapour deficit773 Pa

Wind speed3.00 m/s

Cloud cover22.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)