Siphonochilus aethiopicus

(Schweinf.) B.L.Burtt · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Zingiberales/Zingiberaceae/Siphonochilus

At a glance

Occurrence records1 020

Data sources13

Biological traits17

DNA specimens10

eDNA detections6

Sources13 archives

Databases and archives Siphonochilus aethiopicus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 020 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Chemical compositionLOTUS · NPASS17 compounds

Occurrence & distributionGBIF1 020 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD · NCBI10 specimens

Genome at a glanceCCDB2n = 28

01Narrative

Siphonochilus aethiopicus is a species of plant in the ginger family, Zingiberaceae. It was first described by Georg August Schweinfurth and received its current name from Brian Laurence Burtt.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height0.302 m

Plant height max0.44 m

Plant height min0.15 m

Life cycle & reproduction3

Life formperennial or rhizomatous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max915 m

Elevation min610 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits1

Plant support typefree-standing

03Chemical composition17 compounds

Compounds documented for Siphonochilus aethiopicus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Eudesmane sesquiterpenoids4

Oleanane triterpenoids3

Acyclic monoterpenoids1

Menthane monoterpenoids $ Monocyclic monoterpenoids1

Dihydroflavonols1

Documented compounds17 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Linalool	present	LOTUS
(1S,4S,5R,8R,10S,13R,14R,16R,17S,18R)-10,16-dihydroxy-4,5,9,9,13,20,20-heptamethyl-24-oxahexacyclo[15.5.2.01,18.04,17.05,14.08,13]tetracosan-23-one	present	NPASS
(2alpha,3beta)-2-(Acetyloxy)-3-hydroxy-olean-12-en-28-oic acid	present	NPASS
(4aR,8aR,9aS)-3,8a-dimethyl-4a,5,9,9a-tetrahydro-4H-benzo[f][1]benzofuran-2,8-dione	present	LOTUS
(4aR,8aR,9aS)-9a-hydroxy-3,8a-dimethyl-4,4a,5,9-tetrahydrobenzo[f][1]benzofuran-2,8-dione	present	LOTUS
(4aR,8aS)-3,8a-dimethyl-4a,5-dihydro-4H-benzo[f][1]benzofuran-2,8-dione	present	LOTUS
(4aS,5R,8aR)-2-hydroxy-3,5,8a-trimethyl-4,4a,5,9-tetrahydrobenzo[f][1]benzofuran-8-one	present	LOTUS
(4aS,5R,8aR)-3,5,8a-trimethyl-4,4a,5,9-tetrahydrobenzo[f][1]benzofuran-8-one	present	LOTUS
(4aS,6aR,6aS,6bR,8aR,10R,11R,12aR,14bS)-10-acetoxy-11-hydroxy-2,2,6a,6b,9,9,12a-heptamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid	present	NPASS
(R)-Limonene	present	LOTUS

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Siphonochilus aethiopicus has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes6

GenBank sequences3

eDNA detections6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY769811.1 ↗601 bp

ACGT

TTGTTGAGAGAGCACAAGGAGATGGATGATTGCGAATGTGTTAATGTGTTGCTTTTTCTCACCCCCTTTTGGTGGGTGATTGATGATTAG …

Siphonochilus aethiopicus 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL★rbcLa★trnL-F★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Siphonochilus aethiopicus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 281×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — MAHANTY, H.K. 1970. A cytological study of the Zingiberales with special reference to their taxonomy. Cytologia 35: 13-49.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.506 ↗

08Occurrence & distribution

Record type1 020 records

Wild obs. + sensor761

Museum / vouchered221

Other38

Range

Area of Occupancy AOO1 968 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy57% within 1 km

≤100 m 54≤1 km 24≤10 km 32>10 km 27

137 georeferenced · 624 without coordinates

Open the mapobservation + sensor761

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 4

4 georeferenced · 217 without coordinates

Open the institutions mapphysical evidence221

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MeiseBGlocation not on record	52
Kew, GB	35
Saint Louis, US	33
HNBlocation not on record	15
Instituto de Investigação Científica Tropicallocation not on record	9
National Museums of Kenyalocation not on record	4
Xiamen, CN	4
Edward O. Wilson Biodiversity Laboratory, Gorongosa NPlocation not on record	3
EAlocation not on record	2
South Kensington, GB	2
MAlocation not on record	2
Calabar, NG	2
Frankfurt am Main	2
Arusha, TZ	2
University of Zimbabwelocation not on record	2
University of Johannesburglocation not on record	1
Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record	1
Institute for Agricultural Research of Mozambiquelocation not on record	1
TAFORI-LSRClocation not on record	1
BRLUlocation not on record	1
UJlocation not on record	1
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	1
National Herbarium & Botanic Gardens of Malawilocation not on record	1
Edinburgh, GB	1

24 institutions · 178 of 221 vouchered records shown · 43 without an institution code

09Environmental DNA6 detections

Where the DNA of Siphonochilus aethiopicus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

Mixed miombo Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.2 °C 21.0–26.2

Seasonal swing summer↔winter6.60 °C

Max temp (day)30.6 °C 26.0–30.6

Min temp (night)21.9 °C 16.7–21.9

Precipitation243 mm/mo 71.2–243

Air humidity62.8 % 62.4–62.8

Moisture balance71.6 mm/mo -25.9–71.6

Vapour deficit1,261 Pa 947–1,261

Wind speed1.80 m/s

Cloud cover58.8 % 23.1–58.8

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Siphonochilus aethiopicus

At a glance

Sources13 archives

Size & morphology3

Life cycle & reproduction3

Diet & foraging1

Habitat & environment8

Physiology & chemistry1

Other traits1

Compound class profile5 classes

Documented compounds17 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 020 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 24 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 020 records