Siphonaria gigas

G.B.Sowerby I, 1825 · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Siphonariida/Siphonariidae/Siphonaria

At a glance

Occurrence records600

Data sources7

Biological traits2

DNA specimens13

eDNA detections15

Sources7 archives

Databases and archives Siphonaria gigas's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility491 records↗

OBISOcean Biodiversity Information System109 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS600 records

Environmental DNA2 datasets · 6 countries15 detections

DNA & barcodingBOLD13 specimens

01Narrative

Siphonaria gigas, common name the giant false limpet, is a species of air-breathing sea snail or false limpet, a marine pulmonate gastropod mollusc in the family Siphonariidae, the false limpets.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Siphonaria gigas has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes11

eDNA detections15

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.30%

Haplotypes2

BIN1

Most divergent pair0.46%

Where individuals differ — all 3 variable positions, in barcode order

103Cvariable

298Tvariable

370Avariable

GACCTTGTATATATTATTTGGTATTTGGTGTGGACTTGTTGGGACTGGGCTTTCTTTGCTTATTCGTCTTGAGTTGGGTGTAGCTGGAAG …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_016188 ↗ · 13 protein · 22 tRNA · 2 rRNA

COX1ND6ND5ND1ND4LCYTBCOX2ATP8ATP6ND4ND3COX3ND2l-rRNAs-rRNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type600 records

Wild obs. + sensor354

Museum / vouchered244

Fossil2

Range

Area of Occupancy AOO904 km²

Depth

0–200 m sunlit21

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 12 m · max 25 m · 21 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 169≤1 km 54≤10 km 22>10 km 3

248 georeferenced · 106 without coordinates

Open the mapobservation + sensor354

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy16% within 1 km

≤1 km 18≤10 km 45>10 km 49

112 georeferenced · 132 without coordinates

Open the institutions mapphysical evidence244

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	28
Philadelphia, US	27
Santa Barbara Museum of Natural Historylocation not on record	15
Denver, US	13
ARMS-MBONlocation not on record	11
CASlocation not on record	8
Brussels, BE	7
RBINS-Scientific Heritagelocation not on record	6
Universidad del Valle (UniValle)location not on record	6
Chongqing Museumlocation not on record	5
Natural History Museum Rotterdamlocation not on record	5
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	5
Washington, US	4
Natural History Museum of Utahlocation not on record	3
Delaware Museum of Nature and Sciencelocation not on record	2
ELMClocation not on record	1
Champaign, US	1
Museo Nacional de Ciencias Naturales (CSIC)location not on record	1
New Haven, US	1
Stockholm, SE	1
Provincia di Livornolocation not on record	1

21 institutions · 151 of 244 vouchered records shown

09Environmental DNA15 detections

Where the DNA of Siphonaria gigas was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys2

Countries6

Verifiable raw sequence linked11

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map6 countries0

Marine Protected Area; protected; 9.5 - Subt…Litoral rocosoLong-Term Ecological Research Site; Marine P…Marine Protected Area; protected; 9.2 - Subt…Long-Term Ecological Research Site; LHI (Low…Research site; semi-industrial; 9.5 - Subtid…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.0 °C 6.50–23.4

Seasonal swing summer↔winter17.1 °C

Max temp (day)16.6 °C 8.50–24.8

Min temp (night)11.4 °C 4.00–21.6

Precipitation64.5 mm/mo 47.5–89.2

Air humidity61.8 % 58.6–64.5

Moisture balance-46.5 mm/mo -63.7–-25.3

Vapour deficit612 Pa 387–1,164

Wind speed5.30 m/s 3.00–6.10

Cloud cover41.2 % 34.1–57.3

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)