Siphonaria diemenensis

Quoy & Gaimard, 1833 · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Siphonariida/Siphonariidae/Siphonaria

At a glance

Occurrence records4 669

Data sources8

Biological traits3

DNA specimens12

eDNA detections0

Sources8 archives

Databases and archives Siphonaria diemenensis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 797 records↗

OBISOcean Biodiversity Information System1 872 records↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Chemical compositionLOTUS · NPASS5 compounds

Occurrence & distributionGBIF · OBIS4 669 records

DNA & barcodingBOLD12 specimens

01Narrative

Siphonaria diemenensis, is a species of air-breathing sea snail or false limpet, a marine pulmonate gastropod mollusc in the family Siphonariidae, the false limpets. Dorsal view of shell of Siphonaria diemenensis Quoy & Gaimard, 1833

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Life cycle & reproduction1

Max. longevity72 months

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

03Chemical composition5 compounds

Compounds documented for Siphonaria diemenensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Open-chain polyketides2

Piperidine alkaloids1

Documented compounds5 total

Tissue Source Quantified only

Compound	Amount	Source
1-(3,4-Dihydro-5-(2R)-2-piperidinyl-1(2H)-pyridinyl)ethanone	present	NPASS
BJPDKJGEOOTNHF-LJISPDSOSA-N	present	NPASS
Diemenensin A	present	LOTUS
Diemenensin B	present	LOTUS
MGZIREWUQNMGME-VQJWOFKYSA-N	present	NPASS

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Siphonaria diemenensis has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 31 variable positions, in barcode order

7Gmostly conserved

46Cmostly conserved

55Tmostly conserved

85Amostly conserved

94Cmostly conserved

190Gmostly conserved

238Cmostly conserved

241Gmostly conserved

250Tmostly conserved

268Tmostly conserved

302Tvariable

352Gmostly conserved

397Tmostly conserved

428Cmostly conserved

451Tmostly conserved

463Tmostly conserved

469Amostly conserved

481Gmostly conserved

490Amostly conserved

517Cmostly conserved

550Tmostly conserved

556Gmostly conserved

577Amostly conserved

595Tmostly conserved

607Cmostly conserved

610Cmostly conserved

622Cmostly conserved

628Amostly conserved

631Amostly conserved

643Cmostly conserved

652Tmostly conserved

TACATTGTATATAGTTTTCGGAATATGATGTGGACTTGTAGGTACCGGGCTGAGTCTTCTGATTCGGTTCGAGTTAGGAACTGCAGGTGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.99%

Haplotypes12

BIN1

Most divergent pair1.7%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Siphonaria lateralissame genus16.3%Siphonaria jeanaesame genus17.3%Siphonaria fuegiensissame genus17.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type4 669 records

Wild obs. + sensor1 657

Museum / vouchered3 012

Range

Area of Occupancy AOO5 192 km²

Depth

0–200 m sunlit266

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 0 m · max 24 m · 266 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 547≤1 km 645≤10 km 26>10 km 31

1 249 georeferenced · 408 without coordinates

Open the mapobservation + sensor1 657

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy79% within 1 km

≤100 m 293≤1 km 1 117≤10 km 355>10 km 30

1 795 georeferenced · 1 217 without coordinates

Open the institutions mapphysical evidence3 012

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museums Victorialocation not on record	513
Tasmanian Museum & Art Gallerylocation not on record	303
Sydney, AU	190
QVMAGlocation not on record	122
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	111
AM, TMAGlocation not on record	92
Cambridge, US	28
Museum and Art Gallery of the Northern Territorylocation not on record	16
Philadelphia, US	6
Natick, US	5
Chongqing Museumlocation not on record	4
Denver, US	3
Natural History Museum Rotterdamlocation not on record	3
Paleontological Research Institutionlocation not on record	2
RBINS-Scientific Heritagelocation not on record	2
Champaign, US	2
Brussels, BE	2
ELMClocation not on record	1
Washington, US	1
Toronto, CA	1

20 institutions · 1 407 of 3 012 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Siphonaria diemenensis

At a glance

Sources8 archives

Life cycle & reproduction1

Habitat & environment2

Compound class profile2 classes

Documented compounds5 total

At a glance

Record type4 669 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 20 geolocated

Record type4 669 records