Siphona maculata

Staeger, 1849 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tachinidae/Siphona

At a glance

Occurrence records453

Data sources7

Biological traits0

DNA specimens87

eDNA detections338

Sources7 archives

Databases and archives Siphona maculata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility453 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI338 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics87 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF453 records

Environmental DNA3 datasets · 8 countries338 detections

DNA & barcodingBOLD87 specimens

01Narrative

Siphona maculata is a Palearctic species of fly in the family Tachinidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding87 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Siphona maculata has left across the world's sequence archives.

At a glance

DNA specimens87

BINs3

Marker genes1

eDNA detections338

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus78 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Where individuals differ — all 72 variable positions, in barcode order

1Amostly conserved

4Gmostly conserved

5Tmostly conserved

22Gvariable

23Gmostly conserved

29Gmostly conserved

49Tmostly conserved

50Cmostly conserved

58Tmostly conserved

59Cmostly conserved

64Cmostly conserved

70Tmostly conserved

79Amostly conserved

85Amostly conserved

88Gmostly conserved

91Amostly conserved

100Gvariable

112Cmostly conserved

133Tmostly conserved

136Cmostly conserved

157Tmostly conserved

178Cmostly conserved

193Tmostly conserved

202Tmostly conserved

211Amostly conserved

220Tmostly conserved

232Tmostly conserved

247Cmostly conserved

253Amostly conserved

256Tmostly conserved

268Cmostly conserved

271Cvariable

287Cmostly conserved

289Amostly conserved

290Amostly conserved

293Tmostly conserved

301Amostly conserved

313Tvariable

317Amostly conserved

318Cmostly conserved

322Gmostly conserved

335Gmostly conserved

343Amostly conserved

346Cmostly conserved

347Cmostly conserved

355Tmostly conserved

361Amostly conserved

364Cmostly conserved

367Cmostly conserved

380Gmostly conserved

400Cmostly conserved

401Cmostly conserved

403Tmostly conserved

421Tmostly conserved

427Cmostly conserved

433Amostly conserved

463Tvariable

478Amostly conserved

483Amostly conserved

490Cmostly conserved

511Amostly conserved

514Tvariable

530Cmostly conserved

542Cmostly conserved

550Amostly conserved

557Cmostly conserved

562Amostly conserved

589Tmostly conserved

619Cmostly conserved

631Tmostly conserved

634Cmostly conserved

653Tmostly conserved

AACGTTATATTTTATTTTTGGGGCTTGAGCTGGTATAATAGGAACTTCTCTAAGAATTCTAATCCGAGCTGAATTAGGACACCCAGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.9%

Haplotypes14

BINs3

Most divergent pair10.4%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Siphona intrudenssame genus9.1%Siphona ingeraesame genus9.1%Siphona paucisetasame genus9.9%Siphona luteasame genus9.9%Siphona collinisame genus9.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type453 records

Wild obs. + sensor301

Museum / vouchered152

Range

Area of Occupancy AOO968 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 205≤1 km 72≤10 km 22

299 georeferenced · 2 without coordinates

Open the mapobservation + sensor301

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy90% within 1 km

≤100 m 50≤1 km 30≤10 km 8>10 km 1

89 georeferenced · 63 without coordinates

Open the institutions mapphysical evidence152

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Tokyo, Department of Zoologylocation not on record	26
University of Guelph, Centre for Biodiversity Genomicslocation not on record	20
SLU Artdatabankenlocation not on record	19
University of Guelphlocation not on record	10
DOI/FWS, Kenai National Wildlife Refugelocation not on record	5
Gothenburg, SE	4
Helsinki, FI	4
Metsähallituslocation not on record	3
Finnish Museum of Natural History, Zoological Museumlocation not on record	2
CBDClocation not on record	2
NTNU-VMlocation not on record	2
WIlocation not on record	1
Tampere Museum of Natural Historylocation not on record	1
NHMOlocation not on record	1

14 institutions · 100 of 152 vouchered records shown · 52 without an institution code

09Environmental DNA338 detections

Where the DNA of Siphona maculata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found338

Studies independent surveys3

Countries8

Verifiable raw sequence linked261

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 338 detections have coordinates

Open the map8 countries0

Farmland, coast and birch habitatMixed habitat4. Native Grassland1.1 Boreal Forest1.1. Boreal Forest|1. Forest & Woodland1. Forest & Woodland|1.1 Forest - Boreal

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.2 °C 10.2–14.7

Seasonal swing summer↔winter17.8 °C

Max temp (day)15.7 °C 14.2–19.1

Min temp (night)7.20 °C 5.90–10.9

Precipitation63.1 mm/mo 48.2–88.9

Air humidity58.5 % 55.4–61.0

Moisture balance-46.8 mm/mo -58.5–-15.4

Vapour deficit570 Pa 517–704

Wind speed3.50 m/s 2.40–4.30

Cloud cover45.3 % 38.8–55.9

CHELSA 1981–2010, ~9 km grid, at location & month of 334 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)