Siphona lichtwardtiana

(Villeneuve, 1931) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tachinidae/Siphona

At a glance

Occurrence records31

Data sources7

Biological traits0

DNA specimens9

eDNA detections112

Sources7 archives

Databases and archives Siphona lichtwardtiana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility31 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI112 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF31 records

Environmental DNA3 datasets · 7 countries112 detections

DNA & barcodingBOLD9 specimens

01Narrative

Ceranthia lichtwardtiana is a species of tachinid flies in the genus Ceranthia of the family Tachinidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Siphona lichtwardtiana has left across the world's sequence archives.

At a glance

DNA specimens9

BINs2

Marker genes1

eDNA detections112

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Diversity (π)2.6%

Haplotypes2

BINs2

Most divergent pair0.46%

Where individuals differ — all 59 variable positions, in barcode order

4Amostly conserved

22Amostly conserved

29Gmostly conserved

31Tmostly conserved

38Gmostly conserved

40Gmostly conserved

46Cmostly conserved

64Cmostly conserved

88Amostly conserved

127Amostly conserved

139Tmostly conserved

143Amostly conserved

145Tmostly conserved

154Cmostly conserved

170Gmostly conserved

172Amostly conserved

232Tmostly conserved

256Amostly conserved

263Cmostly conserved

265Tmostly conserved

271Tvariable

274Tmostly conserved

284Tmostly conserved

286Amostly conserved

292Cvariable

295Gmostly conserved

302Tmostly conserved

343Cmostly conserved

347Cmostly conserved

367Tmostly conserved

415Tmostly conserved

421Tmostly conserved

433Amostly conserved

436Cmostly conserved

451Tmostly conserved

457Amostly conserved

478Amostly conserved

490Tmostly conserved

493Tmostly conserved

496Avariable

517Tmostly conserved

529Tmostly conserved

536Tmostly conserved

538Amostly conserved

553Amostly conserved

556Tmostly conserved

557Tmostly conserved

568Tmostly conserved

571Tmostly conserved

595Cmostly conserved

604Tmostly conserved

607Tmostly conserved

610Cmostly conserved

619Tmostly conserved

620Gmostly conserved

631Amostly conserved

634Tmostly conserved

637Tmostly conserved

646Tmostly conserved

TACATTATATTTTATTTTTGGAGCTTGAGCTGGAATAGTGGGAACCTCTTTAAGAATTTTAATCCGAGCTGAATTAGGACATCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Siphona tenuipalpissame genus3.0%Siphona abdominalissame genus3.6%Siphona vernerisame genus4.3%Siphona antennatasame genus7.2%Siphona paucisetasame genus8.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type31 records

Wild obs. + sensor19

Museum / vouchered12

Range

Area of Occupancy AOO92 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 17≤1 km 2

19 georeferenced

Open the mapobservation + sensor19

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 5≤1 km 4

9 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
SLU Artdatabankenlocation not on record	9
Tampere Museum of Natural Historylocation not on record	1

2 institutions · 10 of 12 vouchered records shown · 2 without an institution code

09Environmental DNA112 detections

Where the DNA of Siphona lichtwardtiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found112

Studies independent surveys3

Countries7

Verifiable raw sequence linked30

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 112 detections have coordinates

Open the map7 countries0

ForestSuburban backyardOak savanna14. Artificial - Terrestrial|14.5 Urban AreasWetlandGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.8 °C 12.9–18.6

Seasonal swing summer↔winter25.2 °C

Max temp (day)19.0 °C 15.7–23.9

Min temp (night)11.1 °C 7.80–13.4

Precipitation94.5 mm/mo 62.0–127

Air humidity58.4 % 55.7–64.6

Moisture balance-18.3 mm/mo -56.2–45.0

Vapour deficit695 Pa 563–911

Wind speed3.10 m/s 2.40–4.80

Cloud cover45.4 % 40.8–56.8

CHELSA 1981–2010, ~9 km grid, at location & month of 108 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)