Siphanta acuta

(Walker, 1851) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Flatidae/Siphanta

At a glance

Occurrence records4 456

Data sources7

Biological traits0

DNA specimens21

eDNA detections201

Sources7 archives

Databases and archives Siphanta acuta's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 456 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI201 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF4 456 records

Environmental DNA1 datasets · 5 countries201 detections

DNA & barcodingBOLD21 specimens

01Narrative

Siphanta acuta is a species of planthopper in the family Flatidae; this species is found in various parts of the world. About 10 mm long, they resemble small leaves and are generally found in trees. Siphanta acuta nymph

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Siphanta acuta has left across the world's sequence archives.

At a glance

DNA specimens21

BINs2

Marker genes1

eDNA detections201

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 53 variable positions, in barcode order

1Cmostly conserved

22Gmostly conserved

23Amostly conserved

46Amostly conserved

76Amostly conserved

115Cmostly conserved

121Gmostly conserved

127Gmostly conserved

148Gmostly conserved

151Tmostly conserved

157Cmostly conserved

172Cmostly conserved

175Amostly conserved

196Amostly conserved

217Avariable

220Tmostly conserved

229Gmostly conserved

250Cmostly conserved

265Tvariable

266Cvariable

268Amostly conserved

290Cmostly conserved

310Gmostly conserved

325Amostly conserved

328Gvariable

337Amostly conserved

340Cmostly conserved

343Tmostly conserved

349Cvariable

355Tmostly conserved

364Cmostly conserved

369Cmostly conserved

373Cmostly conserved

400Gvariable

403Amostly conserved

407Amostly conserved

442Tmostly conserved

451Tmostly conserved

457Cmostly conserved

472Cmostly conserved

511Amostly conserved

526Gvariable

539Tmostly conserved

547Avariable

565Tmostly conserved

578Cmostly conserved

595Tmostly conserved

601Tmostly conserved

604Gvariable

607Tmostly conserved

616Cvariable

622Gvariable

631Amostly conserved

CACTCTCTACTTCATTTTAGGGATTTGATCAGGATTAATAGGTATAATAATAAGAATAATTATTCGAATAGAATTATCTCAACCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.3%

Haplotypes13

BINs2

Most divergent pair5.0%

EuropeOceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Colgar rufostigmatumsame family15.2%Siphanta patruelissame genus15.8%Falcophantis westcottisame family16.6%Dworena repletasame family16.7%Metcracis metcalfisame family17.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type4 456 records

Wild obs. + sensor3 617

Museum / vouchered839

Origin

Native7

Introduced236

Range

Area of Occupancy AOO8 020 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 1 898≤1 km 481≤10 km 181>10 km 382

2 942 georeferenced · 675 without coordinates

Open the mapobservation + sensor3 617

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy76% within 1 km

≤100 m 259≤1 km 22≤10 km 81>10 km 7

369 georeferenced · 470 without coordinates

Open the institutions mapphysical evidence839

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UAclocation not on record	236
DPIlocation not on record	221
MWLRlocation not on record	166
New Zealand Arthropod Collectionlocation not on record	83
Auckland, NZ	72
Sydney, AU	31
New Haven, US	9
US	5
University Park, US	3
Western Australian Museumlocation not on record	2
The University of Hawaii Insect Museumlocation not on record	1
San Francisco, US	1
CIBIOlocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1

14 institutions · 832 of 839 vouchered records shown · 7 without an institution code

09Environmental DNA201 detections

Where the DNA of Siphanta acuta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found201

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 201 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.4 °C 14.8–20.9

Seasonal swing summer↔winter10.2 °C

Max temp (day)22.2 °C 18.4–25.2

Min temp (night)13.9 °C 10.5–16.9

Precipitation92.3 mm/mo 37.2–97.9

Air humidity59.1 % 54.4–61.3

Moisture balance-61.9 mm/mo -108–17.8

Vapour deficit882 Pa 647–1,011

Wind speed3.50 m/s 2.40–3.70

Cloud cover26.8 % 20.2–36.6

CHELSA 1981–2010, ~9 km grid, at location & month of 199 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Siphanta acuta

At a glance

Sources7 archives

At a glance

Record type4 456 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 14 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 456 records