Sinpunctiptilia emissalis

Walker, 1864 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pterophoridae/Sinpunctiptilia

At a glance

Occurrence records647

Data sources7

Biological traits0

DNA specimens34

eDNA detections3

Sources7 archives

Databases and archives Sinpunctiptilia emissalis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility647 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics34 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF647 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD34 specimens

01Narrative

Platyptilia omissalis is a moth of the family Pterophoridae. The species was described by Thomas Bainbrigge Fletcher in 1926. It is found in Australia from southern Queensland to Victoria, south-western Australia and Tasmania. Some authors consider it a synonym of Sinpunctiptilia emissalis. Adults have a weak, almost hovering flight. The larvae feed on the leaves of Parahebe species, including Parahebe perfoliata. At first, feeding results in a blotch mine on the upper surface of the leaf. Later, the larvae feed exposed on the upper surface of the leaf. The pupa is elongate, without a cocoon, and rests (fully exposed) on the vegetation attached to a silk pad by hooks at the rear end.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding34 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sinpunctiptilia emissalis has left across the world's sequence archives.

At a glance

DNA specimens34

BINs2

Marker genes2

eDNA detections3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus30 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

217Amostly conserved

229Gmostly conserved

268Amostly conserved

316Amostly conserved

317Gmostly conserved

340Cmostly conserved

343Amostly conserved

379Gmostly conserved

433Gmostly conserved

472Cmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAATTGGAACCTCATTAAGACTACTAATTCGAGCAGAATTAGGAACCCCAGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.24%

Haplotypes5

BINs2

Most divergent pair1.8%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Platyptilia tesseradactylasame family9.4%Rhodostrophia nesamsame order10.9%Comostola pyrrhogonasame order11.9%Hileithia aplicalissame order12.0%Ectropis ligneasame order12.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type647 records

Wild obs. + sensor568

Museum / vouchered79

Range

Area of Occupancy AOO1 164 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 274≤1 km 44≤10 km 16>10 km 28

362 georeferenced · 206 without coordinates

Open the mapobservation + sensor568

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 77 without coordinates

Open the institutions mapphysical evidence79

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Australian National Insect Collectionlocation not on record	71
Australian National Insect Collectionlocation not on record	3
Australian National Fish Collectionlocation not on record	3
Sydney, AU	2

4 institutions · 79 of 79 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Sinpunctiptilia emissalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.4 °C 13.6–18.4

Seasonal swing summer↔winter13.6 °C

Max temp (day)20.5 °C 18.5–23.5

Min temp (night)12.2 °C 8.10–15.8

Precipitation89.2 mm/mo 69.4–110

Air humidity58.3 % 55.4–59.7

Moisture balance-46.5 mm/mo -86.3–-8.40

Vapour deficit847 Pa 654–935

Wind speed4.40 m/s 2.80–4.60

Cloud cover23.0 % 22.1–24.1

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)