Sinowilsonia henryi

Hemsl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Hamamelidaceae/Sinowilsonia

At a glance

Occurrence records153

Data sources11

Biological traits14

DNA specimens8

eDNA detections7

Sources11 archives

Databases and archives Sinowilsonia henryi's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility153 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF153 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD · NCBI8 specimens

Genome at a glanceCCDB2n = 24

01Narrative

Sinowilsonia is a monotypic genus of plant containing the single species Sinowilsonia henryi. It is endemic to China. It is threatened by habitat loss. It is available from specialized commercial nurseries.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Fruit length10 mm

Fruit length max10 mm

Fruit length min10 mm

Plant height8 m

Plant height max5.79 m

Plant height min1.83 m

Life cycle & reproduction3

Deciduousnessdeciduous

Life formshrub or tree

Life spanperennial

Habitat & environment4

Climatetemperate

Climberself-supporting

Growth formtree

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sinowilsonia henryi has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes3

GenBank sequences8

eDNA detections7

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMH658155.1 ↗566 bpChina · 2014

ACGT

AGAGACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTCAATATGAAACCAAAGATACTGA …

Sinowilsonia henryi voucher Q195 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL5★ITS

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Sinowilsonia henryi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidypolyploid inferred

Chromosome records24–242n range24median24mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 246×CCDB · ipcn-api-dl · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · ipcn-api-dl — Morawetz, W. & M. R. A. Samuel. 1989. Karyological patterns in the Hamamelidae. Syst. Assoc. Special Vol. 40(2): 131–135.

CCDB · ipcn-api-dl — Oginuma, K. & H. Tobe. 1991. Karyomorphology and evolution in some Hamamelidaceae and Platanaceae (Hamamelididae; Hamamelidales). Bot. Mag. (Tokyo) 104: 115–135.

CCDB · ipcn-api-dl — Ratter, J. A. & C. Milne. 1976. Chromosome counts in primitive angiosperms: II. Notes Roy. Bot. Gard. Edinburgh 35: 143–145.

CCDB · book-fedorov — Anderson E., Sax 1935

CCDB · book-fedorov — HERNA,NDIACE

CCDB · book-atlas-flowering-plants — Anderson & S. 1935

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type153 records

Wild obs. + sensor1

Museum / vouchered150

Cultivated / captive1

Other1

Range

Area of Occupancy AOO220 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 149 without coordinates

Open the institutions mapphysical evidence150

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	34
Zhengzhou, CN	28
Wuhan, CN	20
Lanzhou, CN	15
Philadelphia, US	5
Guangzhou, CN	4
Xian, CN	4
Chengdu, CN	4
Xinxiang, CN	4
Nanjing, CN	3
University of Stellenboschlocation not on record	3
Herbarium of South China Botanical Gardenlocation not on record	2
WNNUlocation not on record	2
Nanjing, CN	2
Kunming, CN	2
Chinese Academy of Forestrylocation not on record	2
Taipei, TW	2
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	2
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Chongqing Museumlocation not on record	1
Museum of the Rockieslocation not on record	1
Honolulu, US	1
Guilin, CN	1
Davis, US	1
Zürich, CH	1
“Manash Kozybayev North Kazakhstan University" NPLClocation not on record	1
Southwest Forestry Collegelocation not on record	1
Xining, CN	1
Cambridge, US	1
South Kensington, GB	1

30 institutions · 150 of 150 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA7 detections

Where the DNA of Sinowilsonia henryi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median29.2 °C 29.2–29.2

Seasonal swing summer↔winter24.7 °C

Max temp (day)32.0 °C

Min temp (night)26.2 °C

Precipitation264 mm/mo

Air humidity63.0 %

Moisture balance91.8 mm/mo

Vapour deficit1,505 Pa

Wind speed2.90 m/s

Cloud cover40.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)