Sinotaia quadrata

(W.H.Benson, 1842) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Architaenioglossa/Viviparidae/Sinotaia

At a glance

Occurrence records666

Data sources9

Biological traits0

DNA specimens379

eDNA detections37

Sources9 archives

Databases and archives Sinotaia quadrata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility666 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI37 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics379 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF666 records

Environmental DNA1 datasets · 2 countries37 detections

DNA & barcodingBOLD379 specimens

Genome at a glanceGoaT · NCBI≈984 Mbp

01Narrative

Sinotaia aeruginosa (synonym: Bellamya aeruginosa) is a species of freshwater snail with a gill and an operculum, an aquatic gastropod mollusk in the family Viviparidae. It is widely distributed and common species in China and in northern Vietnam inhabiting various shallow freshwater habitats, where it can reach high densities. It is a keystone species in its habitat and can significantly affect water quality and phytoplankton communities. It is commonly used in Chinese cuisine.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding379 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sinotaia quadrata has left across the world's sequence archives.

At a glance

DNA specimens379

BINs40

Marker genes2

eDNA detections37

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus375 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 65 variable positions, in barcode order

16Gmostly conserved

28Gmostly conserved

34Amostly conserved

49Amostly conserved

61Amostly conserved

112Gvariable

127Gmostly conserved

158Cvariable

160Gmostly conserved

169Tmostly conserved

181Gvariable

184Gmostly conserved

190Cvariable

193Tmostly conserved

211Gmostly conserved

217Tmostly conserved

232Tmostly conserved

235Cmostly conserved

247Tvariable

262Gmostly conserved

265Amostly conserved

271Tmostly conserved

274Gvariable

277Tvariable

283Amostly conserved

290Cvariable

298Avariable

301Tmostly conserved

313Tmostly conserved

316Gmostly conserved

340Tvariable

355Tmostly conserved

367Cmostly conserved

373Tmostly conserved

376Amostly conserved

397Cvariable

406Tmostly conserved

418Amostly conserved

448Cmostly conserved

457Gmostly conserved

460Cmostly conserved

474Gmostly conserved

475Gmostly conserved

478Tmostly conserved

487Tmostly conserved

490Amostly conserved

493Tmostly conserved

511Amostly conserved

539Cvariable

544Gmostly conserved

562Avariable

565Gmostly conserved

578Cmostly conserved

580Tmostly conserved

601Cvariable

613Cvariable

616Tvariable

625Avariable

628Amostly conserved

631Gmostly conserved

640Tmostly conserved

646Cvariable

652Cmostly conserved

655Amostly conserved

658Tmostly conserved

AACTTTATATATTTTGTTTGGTGTATGGTCAGGATTAGTTGGTACTGGACTTAGTATTTTAATTCGAATTGAACTTGGTCAACCTGGTAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 38 commonest of 148 variants.

Diversity (π)3.7%

Haplotypes148

BINs40

Most divergent pair11.1%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anularya mansuyisame family5.8%Angulyagra costatasame family7.4%Cipangopaludina ussuriensissame family10.7%Margarya melanioidessame family11.5%Cipangopaludina catayensissame family11.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_031850 ↗ · 13 protein · 22 tRNA · 2 rRNA

COX2ATP8ATP6ND1ND6CYTBND4LND4ND5COX3ND3ND2COX112S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Sinotaia quadrata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈984 328 742 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Sinotaia quadrata0.98 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type666 records

Wild obs. + sensor596

Museum / vouchered58

Other12

Origin

Native12

Range

Area of Occupancy AOO1 476 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 226≤1 km 77≤10 km 7>10 km 33

343 georeferenced · 253 without coordinates

Open the mapobservation + sensor596

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 3≤10 km 3

6 georeferenced · 52 without coordinates

Open the institutions mapphysical evidence58

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Philadelphia, US	28
Ann Arbor, US	13
Barcelona, ES	2
Akita Prefectural Museumlocation not on record	2
Brussels, BE	2
Champaign, US	2
Cambridge, US	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Denver, US	1
Buenos Aires, AR	1
RBINS-Scientific Heritagelocation not on record	1

11 institutions · 54 of 58 vouchered records shown · 4 without an institution code

09Environmental DNA37 detections

Where the DNA of Sinotaia quadrata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found37

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 37 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.0 °C 8.50–10.0

Seasonal swing summer↔winter31.5 °C

Max temp (day)15.7 °C 12.0–15.7

Min temp (night)3.10 °C

Precipitation13.8 mm/mo 13.8–212

Air humidity45.7 % 45.7–57.2

Moisture balance-95.2 mm/mo -95.2–120

Vapour deficit827 Pa 588–827

Wind speed4.50 m/s 3.50–4.50

Cloud cover24.1 % 24.1–36.4

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)