Sinosuthora alphonsiana

(J.Verreaux, 1870) · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Passeriformes/Sylviidae/Sinosuthora

At a glance

Occurrence records19

Data sources5

Biological traits19

DNA specimens11

eDNA detections0

Sources5 archives

Databases and archives Sinosuthora alphonsiana's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility19 records↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources19 traits

Occurrence & distributionGBIF19 records

DNA & barcodingBOLD11 specimens

01Narrative

The ashy-throated parrotbill, (Sinosuthora alphonsiana), is a parrotbill. In old sources, it may be called Alphonse's crow-tit; though superficially resembling a tit it is not a member of the Paridae. The native range of this species extends from south-west China to northern Vietnam, and it might have become naturalised in one area in Italy.Bangs (1932), Robson (2007), BLI (2008)

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAVONETEltonTraits

Size & morphology11

Beak depth5.9 mm

Beak length (culmen)8.6 mm

Beak length (nares)5.3 mm

Beak width3.3 mm

Body mass10.5 g

⚠ sources differ — AVONET: 10.5 g · EltonTraits: 20.73 g

Hand-wing index12.8

Kipp's distance6.7 mm

Secondary length45.5 mm

Tail length65.9 mm

Tarsus length21 mm

Wing length52.2 mm

Diet & foraging4

Invertebrate100 %

Trophic levelherbivore

Trophic nicheOmnivore

Understory100 %

Habitat & environment4

HabitatShrubland

Migration1.0

Primary lifestyleInsessorial

Range size185 799 km²

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sinosuthora alphonsiana has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P663 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

129Tvariable

270Tmostly conserved

331Tvariable

490Tvariable

511Cvariable

543Cvariable

568Cmostly conserved

579Cmostly conserved

612Avariable

621Gvariable

642Avariable

GCCGGAATGGTAGGTACCGCCTTAAGCCTCCTTATTCGAGCAGAACTAGGCCAACCCGGCGCTCTTCTAGGAGACGACCAAATCTACAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.76%

Haplotypes5

BIN1

Most divergent pair1.7%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alcippe poioicephalasame order12.4%Fulvetta vinipectussame family12.6%Oreoscoptes montanussame order12.7%Sylvia communissame order13.0%Fulvetta formosanasame family13.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type19 records

Wild obs. + sensor14

Museum / vouchered5

Range

Area of Occupancy AOO36 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 14 records without

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 5 records without

Open the institutions mapphysical evidence5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)