Sinonovacula constricta

(Lamarck, 1818) · species

image placeholder — illustration coming later

Animalia/Mollusca/Bivalvia/Adapedonta/Pharidae/Sinonovacula

At a glance

Occurrence records397

Data sources11

Biological traits5

DNA specimens164

eDNA detections150

Sources11 archives

Databases and archives Sinonovacula constricta's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility228 records↗

OBISOcean Biodiversity Information System169 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI150 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics164 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF · OBIS397 records

Environmental DNA1 datasets · 1 countries150 detections

DNA & barcodingBOLD164 specimens

Genome at a glanceGoaT · NCBI≈1.3 Gbp

01Narrative

Sinonovacula constricta, the constricted tagelus, Chinese razor clam or Agemaki clam, is a commercially important species of bivalve native to the estuaries and mudflats of China and Japan. It is extensively aquafarmed in China and other countries, with 742,084 tons worth US$667,876,000 harvested in 2008. Salt-baked Duotou clams, a famous Putian dish Clams from Doutuo village in Putian city, Fujian are particularly famous, and are a key ingredient in Putian cuisine.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Uses & economy1

Commercial importancecommercial

Other traits2

Depth max10 m

Depth min0 m

05DNA & barcoding164 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sinonovacula constricta has left across the world's sequence archives.

At a glance

DNA specimens164

BINs2

Marker genes12

eDNA detections150

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P651 bp consensus23 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 16 variable positions, in barcode order

36Amostly conserved

52Tmostly conserved

144Tmostly conserved

174Gmostly conserved

199Cmostly conserved

265Tmostly conserved

297Gmostly conserved

312Cmostly conserved

342Tmostly conserved

345Tmostly conserved

537Amostly conserved

561Amostly conserved

579Amostly conserved

603Cmostly conserved

621Tmostly conserved

624Amostly conserved

GGAACTTTGTATATAATTTTGGCTTTTTGATCAGGATTAGTTGGGACAAGGTTAAGGTTGTTGATTCGATTGGAATTAGCTCGTCCTGGT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes7

BIN1

Most divergent pair1.5%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Orbicularia orbiculatasame family12.6%Novaculina chinensissame family12.7%Novaculina gangeticasame family12.9%Novaculina myanmarensissame family13.7%Cultellus attenuatussame family14.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5Patp6COIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_011075 ↗ · 12 protein · 19 tRNA · 2 rRNA

COX1ND1ND5CYTBND6ATP6COX3ND2COX2ND4LND4ND3l-rRNAs-rRNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Sinonovacula constricta carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 332 234 310 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Sinonovacula constricta1.33 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness76.3% BUSCO

08Occurrence & distribution

Record type397 records

Wild obs. + sensor17

Museum / vouchered380

Range

Area of Occupancy AOO196 km²

Depth

0–200 m sunlit1

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 4 m · max 4 m · 1 record with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 4≤1 km 1≤10 km 2>10 km 3

10 georeferenced · 7 without coordinates

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤1 km 1≤10 km 3>10 km 2

6 georeferenced · 374 without coordinates

Open the institutions mapphysical evidence380

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Marine Biodiversity Institute of Korealocation not on record	163
NSMKlocation not on record	20
Cambridge, US	3
Gyeryonsan Natural History Museumlocation not on record	3
Philadelphia, US	3
Gifu prefectural Museumlocation not on record	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Sam Noble Oklahoma Museum of Natural Historylocation not on record	1
Denver, US	1
Wakayama Prefectural Museum of Natural Historylocation not on record	1
National Institute of Biological Resourceslocation not on record	1
Stockholm, SE	1
Nishinomiya Shell Museumlocation not on record	1
Natural History Museum Rotterdamlocation not on record	1

14 institutions · 202 of 380 vouchered records shown · 9 without an institution code

09Environmental DNA150 detections

Where the DNA of Sinonovacula constricta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found150

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 150 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.0 °C 10.0–10.0

Seasonal swing summer↔winter31.5 °C

Max temp (day)15.7 °C

Min temp (night)3.10 °C

Precipitation13.8 mm/mo

Air humidity45.7 %

Moisture balance-95.2 mm/mo

Vapour deficit827 Pa

Wind speed4.50 m/s

Cloud cover24.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)