Sinoe chambersi

Lee, 2012 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gelechiidae/Sinoe

At a glance

Occurrence records342

Data sources7

Biological traits0

DNA specimens154

eDNA detections156

Sources7 archives

Databases and archives Sinoe chambersi's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility342 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI156 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics154 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF342 records

Environmental DNA1 datasets · 2 countries156 detections

DNA & barcodingBOLD154 specimens

01Narrative

Sinoe chambersi, Hodges #1834.1, Size: 4.9 mm Sinoe chambersi is a moth of the family Gelechiidae. It is found in North America, where it has been recorded from the United States (from Pennsylvania to Mississippi and in California) and from Canada (from Alberta to Quebec).Sinoe at funet The wingspan is 11.4−11.6 mm. The forewings range from dark grey to brown, with a dark brown subbasal fascia and a brown basal patch. There are two dark brown spots on the costa and the discal cell has a dark brown median streak. The apical area has a black median streak beyond the discal cell and there is a dark brown spot at two-thirds of the dorsum. The hindwings are light grey or brown. Adults are on wing from January to March in the south and from March to June in the north.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding154 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sinoe chambersi has left across the world's sequence archives.

At a glance

DNA specimens154

BINs6

Marker genes1

eDNA detections156

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus146 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 34 variable positions, in barcode order

34Amostly conserved

85Avariable

88Amostly conserved

100Amostly conserved

103Cvariable

118Tmostly conserved

160Amostly conserved

187Tvariable

229Gmostly conserved

250Cmostly conserved

259Tvariable

271Cmostly conserved

277Tmostly conserved

284Cvariable

316Amostly conserved

325Cvariable

343Cvariable

346Tvariable

370Gmostly conserved

373Amostly conserved

412Avariable

433Gmostly conserved

478Avariable

512Gvariable

514Tvariable

535Amostly conserved

574Amostly conserved

580Tvariable

610Cmostly conserved

622Avariable

625Avariable

628Gmostly conserved

631Tvariable

643Cvariable

AACATTATATTTTATTTTTGGAATCTGAGCAGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGAGCAGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 41 variants.

Diversity (π)2.2%

Haplotypes41

BINs6

Most divergent pair4.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sinoe kwakaesame genus6.7%Istrianis arenicolellasame family8.9%Glyphodes bicolorsame order9.4%Ornativalva heluanensissame family9.5%Teleiopsis terebinthinellasame family9.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type342 records

Wild obs. + sensor169

Museum / vouchered173

Range

Area of Occupancy AOO540 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 85≤1 km 12≤10 km 7>10 km 10

114 georeferenced · 55 without coordinates

Open the mapobservation + sensor169

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 8

8 georeferenced · 165 without coordinates

Open the institutions mapphysical evidence173

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	58
Mississippi State, US	12
ASUlocation not on record	8
Washington, US	8
St. Paul, US	5
Research Collection of Daniel Handfieldlocation not on record	5
Smithsonian Institution, National Museum of Natural Historylocation not on record	2
Biodiversity Institute of Ontariolocation not on record	1
Cornell University Insect Collectionlocation not on record	1

9 institutions · 100 of 173 vouchered records shown · 73 without an institution code

09Environmental DNA156 detections

Where the DNA of Sinoe chambersi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found156

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 156 detections have coordinates

Open the map2 countries0

14. Artificial - Terrestrial|14.5 Urban Areas1. Forest & Woodland|1.4. Temperate ForestForestMixte - ChampsGulf Coast5. Wetlands (inland) | 5.15. Seasonal/Interm…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.80 °C 4.90–13.5

Seasonal swing summer↔winter28.5 °C

Max temp (day)14.9 °C 10.4–18.8

Min temp (night)3.60 °C -1.00–8.40

Precipitation76.7 mm/mo 30.4–105

Air humidity55.3 % 53.1–59.6

Moisture balance-31.4 mm/mo -54.8–10.4

Vapour deficit496 Pa 402–675

Wind speed3.40 m/s 2.60–4.70

Cloud cover45.8 % 39.6–54.6

CHELSA 1981–2010, ~9 km grid, at location & month of 147 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)