Sinobambusa tootsik

(Makino) Makino ex Nakai · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Sinobambusa

At a glance

Occurrence records57

Data sources10

Biological traits7

DNA specimens2

eDNA detections2

Sources10 archives

Databases and archives Sinobambusa tootsik's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility57 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources7 traits

Occurrence & distributionGBIF57 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 48

01Narrative

Sinobambusa tootsik, is a species of bamboo. It grows to a maximum height of 30 feet, with a maximum diameter of 1.5 inches. The culm sheaths are initially red-brown, and basally suboblong and leathery.Flora of China 22: 147. 2006

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height10 m

Life cycle & reproduction1

Life formbamboo

Diet & foraging1

Parasiteindependent

Habitat & environment4

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sinobambusa tootsik has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences10

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSGQ464845.1 ↗554 bp

ACGT

GGAAGTAAAAGTCGTAACAAGGTCTCCGTAGGTGAACCTGCGGAGGGATCATTAATGAGTGAGGGGGCCACCCCCAACCTCCAACCCTTT …

UNVERIFIED_ORG: Sinobambusa tootsik 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL9★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Sinobambusa tootsik carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 48 n = 24

Ploidypolyploid inferred

Chromosome records48–482n range48median48mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 486×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-atlas-flowering-plants +1

CCDB · ipcn-api-dl — Li, X. l., S. Liu, W. q. Song, R. y. Chen & Y. z. Wang. 1999. Chromosome number of forty species of scattered bamboos. Acta Phytotax. Sin. 37(6): 541–544.

CCDB · ipcn-api-dl — Chen, R. y. & W. x. Zong. 1991. Chromosome numbers of some scattered bamboos. Acta Phytotax. Sin. 29(5): 452–455.

CCDB · book-ipcn67-71 — KONDO, s. 1965. Karyotype analysis on Bambusaceae (3). Rep. Fuji Bamboo Gard. 10: 81-85.

CCDB · book-atlas-flowering-plants — Uchikawa 1933

CCDB · Cave1956supp — Tateoka 1955

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type57 records

Wild obs. + sensor1

Museum / vouchered56

Range

Area of Occupancy AOO132 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced · 54 without coordinates

Open the institutions mapphysical evidence56

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Odawara, JP	13
Hangzhou, CN	11
Bando, JP	7
Beijing, CN	4
Kochi, JP	4
Bronx, US	3
KURAlocation not on record	3
Taipei, TW	2
Sendai, JP	2
Nishihara, JP	1
J.F.Oberlin Universitylocation not on record	1
Osaka, JP	1
Sagamihara, JP	1
Kew, GB	1
Nishihara, JP	1
Kawasaki Shi Tama Ku, JP	1

16 institutions · 56 of 56 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Sinobambusa tootsik was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)