Sinapis pubescens

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Brassicales/Brassicaceae/Sinapis

At a glance

Occurrence records149

Data sources8

Biological traits9

DNA specimens0

eDNA detections3

Sources8 archives

Databases and archives Sinapis pubescens's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility149 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF149 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 18

01Narrative

Sinapis pubescens est une espèce de plantes de la famille des Brassicaceae endémique du bassin méditerranéen.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Life formperennial

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Growth formherb

Woodinessnon-woody

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sinapis pubescens has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences5

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSLN589714.1 ↗287 bp

ACGT

AAGGCTTGGGGGCTTCTTGATCCCGGAAACGGTGTTTGGTCGGAATTCTTGCTTTAATGCAAAGTCTATAATTACTCTCCGTTATTGATA …

Sinapis pubescens genomic DNA containing ITS1, 5.8S rRNA gene and ITS2

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS5

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Sinapis pubescens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode12records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1812×CCDB · ita-fl · CCDB · ipcn-api-dl · CCDB · book-fedorov +1

CCDB · ita-fl — Polatschek A. - 1983. Chromosomenzahlen und Hinweise auf Systematik und Verbreitung von Brassicaceae-Arten aus Europa, Nordafrika, Asien und Australien. Phyton (Horn) , 23(1): 127-139.

CCDB · ita-fl — HARBERD D. J. - 1972 (1972). A contribution to the cyto-taxonomy of Brassica (Cruciferae) and its allies.. Bot. J. Linn. Soc. , 65: 1 - 23.

CCDB · ita-fl — COLOMBO P., MARCEN C. & MAZZA S. - 1987 (1987). Numeros cromosomaticos de plantas occidentales, 436 - 444.. Anales Jardin Botanico de Madrid , 44(1): 140 - 142.

CCDB · ipcn-api-dl — Colombo, P., C. Marceno & S. Mazza. 1987. Numeros cromosomaticos de plantas occidentales, 436--444. Anales Jard. Bot. Madrid 44: 137–142.

CCDB · ipcn-api-dl — Polatschek, A. 1983. Chromosomenzahlen und hinweise auf systematik und verbreitung van Brassicaceae-Arten aus Europa, Nordafrika, Asien und Australien. Phyton (Horn). 23: 127–139.

CCDB · book-fedorov — Manton 1932

CCDB · brass — Polatschek

CCDB · brass — Colombo et al.

CCDB · brass — Manton

CCDB · brass — Gmez-Campo

n 97×CCDB · ita-fl · CCDB · book-ipcn72 · CCDB · book-ipcn67-71 +1

CCDB · ita-fl — LARSEN K., LAEGAARD S. - 1971. Chromosome studies of the sicilian flora.. Bot. Tidsskr. , 66(3): 249-268.

CCDB · book-ipcn72 — HARBERD, D.J. 1972. A contribution to the cytotaxonomy of Brassica (Cruciferael and its allies. Bot. J. Linn. Soc. 65: 1-23.

CCDB · book-ipcn67-71 — LARSEN, K., & s. LAGAARD. 1971. Chromosome studies of the Sicilian flora. Bot. Tidsskr. 66: 2Q9-268.

CCDB · brass — Takahata & Hinata

CCDB · brass — Bertoli

CCDB · brass — Larsen & Laegaard

CCDB · brass — Harberd

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type149 records

Wild obs. + sensor89

Museum / vouchered46

Cultivated / captive4

Other10

Origin

Native6

Introduced2

Range

Area of Occupancy AOO336 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy16% within 1 km

≤100 m 5≤1 km 8≤10 km 58>10 km 10

81 georeferenced · 8 without coordinates

Open the mapobservation + sensor89

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy91% within 1 km

≤100 m 9≤1 km 1≤10 km 1

11 georeferenced · 35 without coordinates

Open the institutions mapphysical evidence46

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 4

4 georeferenced

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wlocation not on record	8
Paris, FR	6
Berlin, DE	6
Institut und Museum fuer Geologie und Palaeontologielocation not on record	5
ESP003location not on record	4
Dresden, DE	2
GJOlocation not on record	2
Frankfurt am Main	2
Barcelona, ES	1
CJBNlocation not on record	1
Salamanca, ES	1
South Kensington, GB	1
Sevilla, ES	1
Saint Louis, US	1

14 institutions · 41 of 46 vouchered records shown · 5 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Sinapis pubescens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)