Sinapis arvensis
speciesAt a glance
Occurrence records226 758
Data sources13
Biological traits65
DNA specimens48
eDNA detections24
Sources13 archives
Databases and archives Sinapis arvensis's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility226 758 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics48 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources65 traits
Chemical compositionLOTUS13 compounds
Occurrence & distributionGBIF226 758 records
Environmental DNA1 datasets · 6 countries24 detections
DNA & barcodingBOLD · NCBI48 specimens
Genome at a glanceCCDB · GoaT577 Mbp
01Narrative
La moutarde des champs, également appelée la sanve, le sénevé, est une espèce de plante annuelle herbacée de la famille des brassicacées, souvent considérée comme une adventice.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRY
Size & morphology24
Fruit length40 mm
⚠ sources differ — AusTraits: 40 mm · GIFT: 33 mm
Fruit length max60 mm
Fruit length min25 mm
Fruit width2.5 mm
⚠ sources differ — AusTraits: 2.5 mm · GIFT: 2 mm
Leaf length200 mm
Leaf length max250 mm
Leaf length min50 mm
Leaf mass429 mg
Leaf size3 162 mm²
⚠ sources differ — TRY: 3 162 mm² · LEDA: 11 733 mm² · GIFT: 9 291 mm²
Leaf width65 mm
Leaf width max70 mm
Leaf width min10 mm
Plant height0.512 m
⚠ sources differ — GIFT: 0.512 m · AusTraits: 0.55 m · LEDA: 0.3 m · TRY: 0.525 m
Plant height generative0.525 m
Plant height max0.8 m
Plant height min0.2 m
Seed length1.45 mm
⚠ sources differ — TRY: 1.45 mm · AusTraits: 1.5 mm · GIFT: 1.9 mm
Seed mass2.09 mg
⚠ sources differ — TRY: 2.09 mg · LEDA: 2.39 mg · GIFT: 2.27 mg
Seed mass max4.2 mg
Seed mass min1.15 mg
Seed volume2 mm³
Seed volume max2 mm³
Seed volume min2 mm³
Seed width1.5 mm
Life cycle & reproduction16
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dispersal typeanimal
⚠ sources differ — LEDA: endozoochor · GIFT: anemochorous
Flower colouryellow
Flower length max12 mm
Flower length min9 mm
Flowering endJul
Flowering startJun
Life spanannual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Reproduction asexualabsent
Seed number2 500
Self fertilizationpresent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment15
Aquaticterrestrial
Climberself-supporting
Elevation max2 200 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typesilique
⚠ sources differ — AusTraits: silique · GIFT: capsule
Growth formherb
Habitat GIFTopen roadsides managed managed open, roadside
Leaf compoundnesssimple
Leaf formlobed
Leaf shapelanceolate
Mycorrhizaabsent
Mycorrhiza type0.000366595
Woodinessnon-woody
Physiology & chemistry5
Leaf dry-matter content (LDMC)122 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index1
Specific leaf area (SLA)40.37 mm²/mg
⚠ sources differ — TRY: 40.37 mm²/mg · LEDA: 32.6 mm²/mg · GIFT: 39.01 mm²/mg
Other traits3
Diaspore typeone-seeded generative dispersule
Inflorescenceraceme
Shoot orientationerect
03Chemical composition13 compounds
Compounds documented for Sinapis arvensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Glucosinolates3
Stigmastane steroids2
Carboline alkaloids1
Flavones1
Aminoacids1
Documented compounds13 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| 4-Hydroxybenzylamine | present | LOTUS | |
| 5,7-dihydroxy-2-(4-hydroxyphenyl)-6-[(2R,3R,4R,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]chromen-4-one | present | LOTUS | |
| Astragalin | present | LOTUS | |
| beta-Amyrin | present | LOTUS | |
| beta-Sitosterol | present | LOTUS | |
| Brassilexin | present | LOTUS | |
| Erucic Acid | present | LOTUS | |
| Glucorafanin | present | LOTUS | |
| Glucosinalbin | present | LOTUS | |
| Sinigrin | present | LOTUS |
05DNA & barcoding48 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sinapis arvensis has left across the world's sequence archives.
At a glance
DNA specimens48
Marker genes9
GenBank sequences10
eDNA detections24
Countries7
The DNA barcodea real sequence read deposited for this species
TTCAATCCAAATGGAGAAATTTCAAGGATATTTAGAGTTCGATGGGGCTCGGCAACAGAGTTTTCTATATCCACTTTTTTTTCGGGAGTA …
Mutarda arvensis subsp. arvensis isolate SV_18 maturase K (matK) gene, partial cds; chloroplast
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK10★rbcL★rbcLa★trnL-F★ITS★ITS2atpF-atpHrpoC1trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Sinapis arvensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size577 020 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Sinapis arvensis0.58 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 18 n = 9
Ploidy2× diploid · measured
Chromosome records16–182n range18median18mode97records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1896×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +17
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1974a: Index of chromosome numbers of Slovakian flora (Part 3). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 22: 1-20.
CCDB · brit-fl — Harberd, D.J. Bot. J. Linn. Soc. 65: 1-23 (1972)
CCDB · brit-fl — Sikka, S.M. J. Genet. 40: 441-509+pl.xvi-xx (1940)
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. IX. Cruciferae Queirs, M.Bol. Soc. Brot. ser. 247: 315-335(1973).
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 40-44. Cardona, M. A.Lagascalia7(2): 212-216(1977).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2391
CCDB · fl-europaea — Lbvkvist, 1963
CCDB · poland — Pogan E., Izmai?ow R. et al. 1983. Further studies in chromosome numbers of Polish Angiosperms. Part XVII. Acta Biol. Cracov. Ser. Bot. 25, 57-77.
CCDB · poland — Frey L., Mizianty M. and Mirek Z. 1981. Chromosome numbers of Polish vascular plants. Fragm. Flor. Geobot. 27, 581-590.
CCDB · ipcn-api-dl — Pogan, E. 1983. Further studies in chromosome numbers of Polish angiosperms. Part XVII. Acta Biol. Cracov., Ser. Bot. 25: 57–77.
CCDB · ipcn-api-dl — Krahulcová, A. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — LABADIE, J. 1979. Etude caryosystematique de quelques especes de la flore d'Algerie. Nat. Monspel., Sér. Bot. 32: 1–11.
CCDB · ipcn-api-dl — LABADIE, J. 1979a. In IOPB chromosome number reports LXV. Taxon 28: 628–629.
CCDB · ipcn-api-dl — LOON VAN, J. C. & H. D. JONG. 1978. In IOPB chromosome number reports LIX. Taxon 27: 53–61.
CCDB · ipcn-api-dl — Cardona, M. A. 1978. Numeros 40-44 in Numeros cromosomicos para la flora Espanola 1-44. Lagascalia 7: 191–216.
CCDB · ipcn-api-dl — Ancev, M. E. 1978b. In IOPB chromosome number reports LXII. Taxon 27: 519–535.
CCDB · ipcn-api-dl — Hasterok, R., E. Wolny, M. Hosiawa, M. Kowalczyk, S. Kulak-Ksiazczyk, T. Ksiazczyk, W. K. Heneen & J. Maluszynska. 2006. Comparative analysis of rDNA distribution in chromosomes of various species of Brassicaceae. Ann. Bot. (Oxford) 97: 205–216.
CCDB · ipcn-api-dl — Kiehn. 2000. In K. Pascher, S. Macalka-Kampfer & H. Reiner, Vegetationsökologische und genetische Grundlagen für die Risiko-Beurteilung von Freisetzungen von Transgenem Raps und Vorschläge für ein Monitoring. Forschungsber. Bundesminist. Soziale Sicherheit Generationen Sekt. IX 7: 46.
CCDB · ipcn-api-dl — Frey, L., M. Mizianty & Z. Mirek. 1981. Chromosome numbers of Polish vascular plants. Fragm. Florist. Geobot. 27: 581–590.
CCDB · ipcn-api-dl — Hijazy, H. Y. 2005. Cytogenetic and molecular reevaluation of the relationships of species belonging to the two genera Brassica and Sinapis. Cytologia 70: 447–454.
CCDB · book-ipcn67-71 — CURRAN, P.L. 1968. Chromosome numbers of sone Irish plants. Irish Naturalists' J. 16: 7-9.
CCDB · book-ipcn67-71 — PODLECH, D., & A. DIETERLE. 1969. Chromosomenstudien an afghanischen Pflanzen. Candollea 24: 185-243.
CCDB · book-ipcn67-71 — GADELLA, Th. W. J., & E. KLIPHUIS. 1966.' Chromosome numbers of flowering plants in the Netherlands II. Proc. Roy. Neth. Acad. Sci. Ser. C. 69: 541-556.
CCDB · book-ipcn75-78 — Loon & Jong 1978
CCDB · book-ipcn75-78 — Ancev 1978
CCDB · book-ipcn75-78 — Cardona 1978
CCDB · book-northern-plants — Nagai & Sasaoka 1930. L. & L. 1944 b.
CCDB · book-ipcn73-74 — QUEIROS, M. 1973. Contribuicao para o conhecimento citotaxonomico d~ Spermatophyta de Portugal. IX. Cruciferae. Bol. Soc. Brot. 47(Ser. 2 315 335. I
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian flora. (Part 3). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 22: 1-20.
CCDB · eflora
CCDB · book-fedorov — Nagai, Sasaoka 1930a
CCDB · book-fedorov — Sikka 1940
CCDB · book-fedorov — Rapne'leHKO 1924a
CCDB · book-fedorov — Tischler 1934, 1937
CCDB · book-fedorov — Haga (Matsuura 1939)
CCDB · book-fedorov — Love A., LOve D. 1944b
CCDB · book-fedorov — Felfoldy 1947a
+51 more references
2n 161×CCDB · brass
CCDB · brass — Easterly
n 940×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn66 +4
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 720-747. Santa Brbara, C. & al.Lagascalia17(2): 367-379(1994).
CCDB · ipcn-api-dl — Al-Shehbaz, I. A. & M. M. Al-Omar. 1982. In IOPB chromosome number reports LXXVI. Taxon 31: 587–589.
CCDB · ipcn-api-dl — Mulligan, G. A. 1984. Chromosome numbers of some plants native and naturalized in Canada. Naturaliste Canad. 111: 447–449.
CCDB · ipcn-api-dl — Warwick, S. I., L. D. Black & J. K. Anderson. 1994. IOPB chromosome data 7. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 22: 4–5.
CCDB · ipcn-api-dl — LABADIE, J. 1979. Etude caryosystematique de quelques especes de la flore d'Algerie. Nat. Monspel., Sér. Bot. 32: 1–11.
CCDB · book-ipcn66 — Fukushima & Iwase 1964
CCDB · book-ipcn72 — HARBERD, D.J. 1972. A contribution to the cytotaxonomy of Brassica (Cruciferael and its allies. Bot. J. Linn. Soc. 65: 1-23.
CCDB · book-ipcn67-71 — SHIVE, J.B., Jr. 1969. In IOPB chromosome number reports XXII. Taxon 18: 433-442.
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · brass — Takahata & Hinata
CCDB · brass — Taylor & Mulligan
CCDB · brass — Mulligan
CCDB · brass — Warwick et al.
CCDB · brass — Lan & Cheo
CCDB · brass — Harberd
CCDB · brass — Tischler
CCDB · brass — Al-Shehbaz & Al-Omar
CCDB · brass — Curran
CCDB · brass — Santa Brbara et al.
CCDB · brass — Sikka
CCDB · brass — Shive
CCDB · CromoCat 2015 — Al-Shehbaz, I. A. & Al-Omar, M. M. (1982). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXVII]. Taxon 31(3): 587-589.
CCDB · CromoCat 2015 — Harberd, D. J. (1972). A contribution to the cyto-taxonomy of Brassica (Cruciferae) and its allies. Bot. J. Linn. Soc. 65(1): 1-23.
CCDB · CromoCat 2015 — Santa Bárbara, C., J. Vioque, R. Juan, J. Pastor & J. C. Diosdado. (1994). Números cromosómicos para la flora española. 720-747. Lagascalia 17(2): 367-379.
CCDB · CromoCat 2015 — Taylor, R. L. & G. A. Mulligan. (1968). Flora of the Queen Charlotte Island. Part 2. Cytologiacl aspects of the Vascular Plants. Queen's Printer Ottawa
CCDB · CromoCat 2015 — Warwick, S. I., L. D. Black & J. K. Anderson. (1994). IOPB Chromosome Data 7 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 22: 4-5.
n 81×CCDB · brass
CCDB · brass — Easterly
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type226 758 records
Wild obs. + sensor214 621
Museum / vouchered11 160
Cultivated / captive45
Other932
Origin
Native1 477
Introduced9 566
Range
Area of Occupancy AOO309 096 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy27% within 1 km
≤100 m 18 008≤1 km 32 221≤10 km 136 086>10 km 2 370
188 685 georeferenced · 25 936 without coordinates
Open the mapobservation + sensor214 621
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy43% within 1 km
≤100 m 550≤1 km 2 608≤10 km 4 051>10 km 192
7 401 georeferenced · 3 759 without coordinates
Open the institutions mapphysical evidence11 160
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy4% within 1 km
≤1 km 1≤10 km 6>10 km 16
23 georeferenced · 22 without coordinates
Open the mapnot free-living45
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions177 of 302 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 4 720 |
| LDlocation not on record | 416 |
| BFLlocation not on record | 358 |
| DAOlocation not on record | 311 |
| BIO-UNIPIlocation not on record | 292 |
| Berlin, DE | 196 |
| DBF-NHMDlocation not on record | 179 |
| Madison, US | 152 |
| Salzburg, AT | 151 |
| SLU Artdatabankenlocation not on record | 137 |
| MeiseBGlocation not on record | 135 |
| Oskarshamn, SE | 126 |
| St. Paul, US | 108 |
| Uniwersytet Warszawskilocation not on record | 105 |
| Olocation not on record | 77 |
| Adam Mickiewicz University in Poznańlocation not on record | 72 |
| Tartu, EE | 70 |
| MAlocation not on record | 64 |
| Chongqing Museumlocation not on record | 63 |
| Helsinki, FI | 57 |
| Bronx, US | 56 |
| South Kensington, GB | 56 |
| Burlington, US | 45 |
| Ann Arbor, US | 44 |
| Bern, CH | 44 |
| Mount Annan, AU | 43 |
| Vitoria, ES | 43 |
| BClocation not on record | 43 |
| Görlitz, DE | 40 |
| Provincia di Livornolocation not on record | 40 |
| Garðabær, IS | 38 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 38 |
| Adelaide, AU | 38 |
| Santa Barbara, US | 37 |
| BRNUlocation not on record | 37 |
| Wuzhou, CN | 37 |
| Pamplona, ES | 36 |
| València, ES | 36 |
| College of the Atlantic, Museumlocation not on record | 36 |
| San Sebastián, ES | 35 |
| San Diego, US | 32 |
| Hobart, AU | 31 |
| Davis, US | 30 |
| Uniwersytet Jagiellońskilocation not on record | 30 |
| Tallinn, EE | 29 |
| Canadian Department of Agriculturelocation not on record | 29 |
| Dresden, DE | 29 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 28 |
| Chadron, US | 28 |
| BDBClocation not on record | 27 |
| Jyväskylä, FI | 26 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 26 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 26 |
| GJOlocation not on record | 25 |
| Entomological Society of Latvialocation not on record | 25 |
| Museo Entomologico de Leonlocation not on record | 23 |
| Claremont, US | 23 |
| CASlocation not on record | 22 |
| San Luis Obispo, US | 22 |
| University of New Hampshirelocation not on record | 21 |
| ISAlocation not on record | 21 |
| UGentlocation not on record | 21 |
| WTUlocation not on record | 21 |
| Acadia Universitylocation not on record | 20 |
| Salamanca, ES | 20 |
| Paris, FR | 20 |
| Mlocation not on record | 20 |
| Pullman, US | 20 |
| Green Bay, US | 19 |
| Saint John, CA | 19 |
| Natural History Museum Rotterdamlocation not on record | 19 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 18 |
| ASUlocation not on record | 18 |
| UIBlocation not on record | 18 |
| Wlocation not on record | 18 |
| Bloomington, US | 18 |
| Uppsala, SE | 18 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 17 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 17 |
| Université Lavallocation not on record | 16 |
| Barcelona, ES | 15 |
| Madrid, ES | 15 |
| Toronto, CA | 15 |
| Christchurch, NZ | 14 |
| 14 | |
| CJBGlocation not on record | 14 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 14 |
| Odawara, JP | 13 |
| Uniwersytet Opolskilocation not on record | 13 |
| San Isidro, AR | 13 |
| Alicante, ES | 13 |
| ESP003location not on record | 12 |
| Armidale, AU | 12 |
| University of Stellenboschlocation not on record | 12 |
| Tilburg, NL | 12 |
| Phoenix, US | 11 |
| Brisbane, AU | 11 |
| Riverside, US | 11 |
| Pamplona, ES | 11 |
| Porrentruy, CH | 11 |
| Corvallis, US | 10 |
| Rishon Le Zion, IL | 10 |
| University of Alberta Museumslocation not on record | 10 |
| Philadelphia, US | 10 |
| Canberra, AU | 10 |
| Montréal, CA | 9 |
| Kensington, AU | 9 |
| Saint Louis, US | 9 |
| Porvoo, FI | 9 |
| Tampa, US | 9 |
| Missoula, US | 9 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 8 |
| SZUlocation not on record | 8 |
| Zürich, CH | 8 |
| CICYTEXlocation not on record | 7 |
| Kushiro City Museumlocation not on record | 7 |
| Moscow, US | 7 |
| Spearfish, US | 7 |
| Auckland, NZ | 7 |
| Austin, US | 7 |
| Wellington, NZ | 6 |
| Denton, US | 6 |
| Gijón, ES | 6 |
| Pretoria, ZA | 6 |
| Kew, GB | 6 |
| NMBU:MINAlocation not on record | 6 |
| Fort Worth, US | 6 |
| Zürich, CH | 5 |
| Ashland, US | 5 |
| Bourges, FR | 5 |
| Badajoz, ES | 5 |
| Granada, ES | 5 |
| Corrientes, AR | 5 |
| University of Guelph, OAC Herbariumlocation not on record | 5 |
| Mexico City, MX | 5 |
| Sevilla, ES | 5 |
| Vancouver, CA | 5 |
| JBSlocation not on record | 5 |
| Davenport, US | 5 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 5 |
| Nagano City, JP | 5 |
| Québec, CA | 5 |
| Stockholm, SE | 5 |
| Frankfurt am Main | 5 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 5 |
| AASlocation not on record | 4 |
| Chapel Hill, US | 4 |
| Tokushima, JP | 4 |
| Musée des Confluenceslocation not on record | 4 |
| Moscow State Universitylocation not on record | 4 |
| Ciudad Autónoma de Buenos Aires, AR | 4 |
| DOI/NPS, Greenbelt Parklocation not on record | 4 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 4 |
| Chicago, US | 4 |
| Logan, US | 4 |
| Nijmegen, NL | 4 |
| Uberlândia, BR | 4 |
| Pocatello, US | 4 |
| BSBIlocation not on record | 4 |
| Karlsruhe, DE | 4 |
| Arcata, US | 4 |
| Glarus, CH | 4 |
| Millersville, US | 3 |
| Mississippi State, US | 3 |
| Emporia, US | 3 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 3 |
| UoB-IBlocation not on record | 3 |
| Tomioka, JP | 3 |
| Jurica-Suchy Nature Museumlocation not on record | 3 |
| Albuquerque, US | 3 |
| Whitewater, US | 3 |
| Turlock, US | 3 |
| National Museum Waleslocation not on record | 3 |
| McWane Science Centerlocation not on record | 3 |
| Hiratsuka City Museumlocation not on record | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| EL PASO, US | 3 |
| John T. Waterhouse Herbariumlocation not on record | 3 |
| Uniwersytet Śląski w Katowicachlocation not on record | 3 |
| Frauenfeld, CH | 3 |
| San Jose, US | 3 |
| Fredericton Stock Culture Collectionlocation not on record | 3 |
| Brussel, BE | 3 |
| Flagstaff, US | 3 |
| Jaén, ES | 3 |
| John May Museum of Natural Historylocation not on record | 2 |
| Durban, ZA | 2 |
| Tsukuba, JP | 2 |
| US | 2 |
| KIRMlocation not on record | 2 |
| Universidad de La Salle (La Salle)location not on record | 2 |
| Chiba, JP | 2 |
| GB | 2 |
| Philadelphia, US | 2 |
| Los Angeles, US | 2 |
| Hamilton, US | 2 |
| Banyoles, ES | 2 |
| Pittsburg, US | 2 |
| IDElocation not on record | 2 |
| PrivatHerblocation not on record | 2 |
| OLAlocation not on record | 2 |
| Mendoza, AR | 2 |
| Boise, US | 2 |
| Miami, US | 2 |
| Otaru, JP | 2 |
| Fulda, DE | 2 |
| Edinburgh, GB | 2 |
| Coimbra, PT | 2 |
| SIHUlocation not on record | 2 |
| Maringá, BR | 2 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 2 |
| Monastir, TN | 2 |
| BISHlocation not on record | 2 |
| Sagamihara, JP | 2 |
| PRClocation not on record | 2 |
| Fayetteville, US | 2 |
| Philadelphia, US | 2 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| Northridge, US | 2 |
| Denver, US | 2 |
| Toyama, JP | 1 |
| nbflocation not on record | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| Córdoba, AR | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| Montréal, CA | 1 |
| Macomb, US | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| Edmonton, CA | 1 |
| EEZA-CSIClocation not on record | 1 |
| DASSHlocation not on record | 1 |
| GZUlocation not on record | 1 |
| Irvine, US | 1 |
| LNBG$location not on record | 1 |
| Forssa, FI | 1 |
| JP | 1 |
| Science Museum of Minnesotalocation not on record | 1 |
| La Trobe Universitylocation not on record | 1 |
| Juriquilla, MX | 1 |
| STUlocation not on record | 1 |
| Namur, BE | 1 |
| San Angelo, US | 1 |
| Córdoba, ES | 1 |
| IPE-CSIClocation not on record | 1 |
| UFMGlocation not on record | 1 |
| Santa Cruz, US | 1 |
| Beijing, CN | 1 |
| Lincoln, US | 1 |
| Xiamen, CN | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Winterthur, CH | 1 |
| Whitehorse, CA | 1 |
| Kirksville, US | 1 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 1 |
| ZRC-SAZUlocation not on record | 1 |
| WINlocation not on record | 1 |
| Sanda, JP | 1 |
| Victoria, CA | 1 |
| Stephenville, US | 1 |
| JBCLMlocation not on record | 1 |
| Richmond, US | 1 |
| Universidad Nacional de La Pampalocation not on record | 1 |
| US | 1 |
| Tulane Universitylocation not on record | 1 |
| Universidad de Caldas (UCaldas)location not on record | 1 |
| Buenos Aires, AR | 1 |
| Catalina Island Conservancylocation not on record | 1 |
| Clemson, US | 1 |
| ESP109location not on record | 1 |
| Tromso University Museumlocation not on record | 1 |
| Tacoma, US | 1 |
| LfUlocation not on record | 1 |
| H-Dunkellocation not on record | 1 |
| H-Meierottlocation not on record | 1 |
| H-Hohlalocation not on record | 1 |
| Cape Town, ZA | 1 |
| College Park, US | 1 |
| Urumqi, CN | 1 |
| Orem, US | 1 |
| Portland, US | 1 |
| UnBlocation not on record | 1 |
| Guatemala City, GT | 1 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 1 |
| Rotorua, NZ | 1 |
| J.F.Oberlin Universitylocation not on record | 1 |
| Sion, CH | 1 |
| GAlocation not on record | 1 |
| Cambridge, US | 1 |
| AUAlocation not on record | 1 |
| CNF-UFHBlocation not on record | 1 |
| FUNEDlocation not on record | 1 |
| Dhaka, BD | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Hunan Geological Museumlocation not on record | 1 |
| Hermosillo, MX | 1 |
| Calabar, NG | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| Nanjing, CN | 1 |
| H-AkrKGlocation not on record | 1 |
| Mount Pleasant, US | 1 |
| BAYLUlocation not on record | 1 |
302 institutions · 10 369 of 11 160 vouchered records shown · 633 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA24 detections
Where the DNA of Sinapis arvensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found24
Studies independent surveys1
Countries6
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 24 detections have coordinates
Open the map6 countries0
Weedy roadside ditchon roadside
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.0 °C 5.50–21.0
Seasonal swing summer↔winter21.6 °C
Max temp (day)17.9 °C 6.90–24.6
Min temp (night)10.4 °C 4.20–17.4
Precipitation84.2 mm/mo 62.1–111
Air humidity60.8 % 57.3–66.2
Moisture balance-25.1 mm/mo
Vapour deficit698 Pa 304–988
Wind speed3.70 m/s
Cloud cover48.0 % 38.4–55.2
CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.