Simulium latipes

(Meigen, 1804) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Simuliidae/Simulium

At a glance

Occurrence records104

Data sources6

Biological traits0

DNA specimens22

eDNA detections69

Sources6 archives

Databases and archives Simulium latipes's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility104 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI69 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF104 records

Environmental DNA3 datasets · 3 countries69 detections

DNA & barcodingBOLD22 specimens

01Narrative

Simulium latipes is a species of fly in the family Simuliidae. It is found in the Palearctic .Fauna EuropaeaBei-Bienko, G.Y. & Steyskal, G.C. (1988) Keys to the Insects of the European Part of the USSR, Volume V: Diptera and Siphonaptera, Parts I, II. Amerind Publishing Co., New Delhi.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Simulium latipes has left across the world's sequence archives.

At a glance

DNA specimens22

BINs3

Marker genes1

eDNA detections69

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 40 variable positions, in barcode order

18Tmostly conserved

22Avariable

37Avariable

40Avariable

74Cmostly conserved

88Amostly conserved

118Tvariable

145Cvariable

166Gvariable

169Gvariable

229Avariable

232Gvariable

271Cvariable

274Avariable

283Tvariable

284Cvariable

328Avariable

331Amostly conserved

334Gvariable

355Avariable

364Tvariable

376Tvariable

379Avariable

412Tvariable

433Gvariable

466Amostly conserved

469Avariable

478Gmostly conserved

484Tvariable

490Tvariable

496Avariable

500Cvariable

541Avariable

542Tmostly conserved

550Avariable

565Amostly conserved

595Tvariable

601Tmostly conserved

619Gvariable

628Gvariable

AACTCTTTATTTTATTTTTGGAGCTTGAGCCGGAATAGTAGGAACCTCTTTAAGTATACTAATTCGAGCTGAACTTGGACATCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.8%

Haplotypes10

BINs3

Most divergent pair5.6%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Simulium usovaesame genus10.3%Simulium anatinumsame genus10.4%Simulium dogielisame genus10.5%Simulium congareenarumsame genus10.9%Simulium travisisame genus11.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type104 records

Wild obs. + sensor77

Museum / vouchered27

Range

Area of Occupancy AOO284 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 49≤1 km 3≤10 km 15

67 georeferenced · 10 without coordinates

Open the mapobservation + sensor77

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤100 m 5≤10 km 11

16 georeferenced · 11 without coordinates

Open the institutions mapphysical evidence27

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CBDClocation not on record	9
Edmonton, CA	3
New Haven, US	2
DFlocation not on record	2

4 institutions · 16 of 27 vouchered records shown · 11 without an institution code

09Environmental DNA69 detections

Where the DNA of Simulium latipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found69

Studies independent surveys3

Countries3

Verifiable raw sequence linked46

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 69 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.8 °C 8.90–14.1

Seasonal swing summer↔winter17.7 °C

Max temp (day)15.0 °C 10.4–18.0

Min temp (night)7.00 °C 5.70–10.6

Precipitation53.3 mm/mo 38.8–74.3

Air humidity59.1 % 57.3–61.5

Moisture balance-41.6 mm/mo -57.5–-32.9

Vapour deficit530 Pa 447–636

Wind speed2.70 m/s 2.50–4.20

Cloud cover39.1 % 37.4–43.6

CHELSA 1981–2010, ~9 km grid, at location & month of 67 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)