Simethis mattiazzii

(Vand.) Sacc. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asphodelaceae/Simethis

At a glance

Occurrence records2 638

Data sources10

Biological traits15

DNA specimens2

eDNA detections2

Sources10 archives

Databases and archives Simethis mattiazzii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 638 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF2 638 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 48

01Narrative

Simethis is a genus of plants in the family Asphodelaceae, subfamily Hemerocallidoideae. It contains only one known species, Simethis mattiazzii, commonly called the Kerry lily.Kew World Checklist of Selected Plant Families, wcsp.science.kew.orgAltervista Flora Italiana, Lilioasfodelo di Mattiazzi, Xanthorrhoeaceae: Simethis mattiazzi (Vandelli) Sacc. It grows in dry places especially near the coast in Western Europe (Ireland, France, Spain, Portugal, Italy) and northern Africa (Algeria, Morocco, Tunisia). Its common name is based on its occurrence at a few sites in County Kerry, Ireland.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Leaf size316 mm²

Plant height0.3 m

Seed mass2.81 mg

Life cycle & reproduction3

Life formrhizomatous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition2 compounds

Compounds documented for Simethis mattiazzii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Anthraquinones and anthrones1

Naphthalenes and derivatives1

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Chrysophanol		present	LOTUS
Nepodin		present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Simethis mattiazzii has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections2

The DNA barcodea real sequence read deposited for this species

rbcLZ69231.1 ↗1 341 bp

ACGT

AAGTGTTGGATTTAAAGCTGGTGTTAAAGATTACAGATTGACTTATTATACTCCTGATTACGAAACCAAAGATACTGATATCTTGGCAGC …

S.mattiazzii chloroplast rbcL gene

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Simethis mattiazzii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 48 n = 24

Ploidypolyploid inferred

Chromosome records24–482n range48median48mode8records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 486×CCDB · iber-fl · CCDB · fl-europaea · CCDB · ipcn-api-dl +2

CCDB · iber-fl — Contribution la connaissance cytotaxonomique des spermatophyta du Portugal. VIII. Liliaceae Barros Neves, J.Bol. Soc. Brot. ser. 247: 157-212(1973).

CCDB · iber-fl — Sobre a cariologia de algumas plantas da Serra do Geres. Fernandes, A.Agron. Lusit.12(4): 551-600(1950).

CCDB · fl-europaea — Barros Neves, 1973

CCDB · ipcn-api-dl — Johnson, M. A. T. & P. E. Brandham. 1997. New chromosome numbers in petaloid monocotyledons and in other miscellaneous angiosperms. Kew Bull. 52(1): 121–138.

CCDB · book-ipcn73-74 — BARROS NEVES, J. 1973. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. VIII. Liliaceae. Bol. Soc. Brot. 47(Ser. 2}: 157 212.

CCDB · book-atlas-flowering-plants — Fernandes 1950b

2n 242×CCDB · ita-fl · CCDB · book-ipcn67-71

CCDB · ita-fl — LOCATELLI-LANZARA P., MARCHI P., MOSKOVA R. - 1971. Numeri cromosomici per la flora italiana:82.. Inform. Bot. Ital. , 3(2): 149.

CCDB · book-ipcn67-71 — LOCATELLI-LANZARA, P., P. MARCHI, & R. MOSKOVA. 1971. In Numeri cromosomici per la flora Italiana. Inf. Bot. Italiano 3: 124-157.

n 122×CCDB · ita-fl · CCDB · ipcn-api-dl

CCDB · ita-fl — CAPINERI R., D'AMATO G., MARCHI P. - 1979 (1978). Numeri cromosomici per la flora italiana:534-583.. Inform. Bot. Ital. , 10(3): 421-465.

CCDB · ipcn-api-dl — Capineri, R., G. D'Amato & P. Marchi. 1978. Numeri cromosomici per la Flora Italiana. 534-583. Inform. Bot. Ital. 10: 421-465.

n 242×CCDB · iber-fl · CCDB · ipcn-api-dl

CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 373-381. Fernndez, I., M. J. Dez & J. Pastor.Lagascalia13(2): 299-302(1985).

CCDB · ipcn-api-dl — Fernández, I., M. J. Díez & J. Pastor. 1985. Números 373-381, in Números cromosómicos para la flora española. 363-434. Lagascalia 13: 299–302.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 638 records

Wild obs. + sensor2 361

Museum / vouchered266

Other11

Origin

Native65

Range

Area of Occupancy AOO6 144 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 702≤1 km 368≤10 km 385>10 km 50

1 505 georeferenced · 856 without coordinates

Open the mapobservation + sensor2 361

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy74% within 1 km

≤100 m 14≤1 km 28≤10 km 14>10 km 1

57 georeferenced · 209 without coordinates

Open the institutions mapphysical evidence266

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MAlocation not on record	55
ISAlocation not on record	49
BIO-UNIPIlocation not on record	37
Vitoria, ES	24
BClocation not on record	21
Entomological Society of Latvialocation not on record	13
Chicago, US	11
BDBClocation not on record	9
València, ES	9
Salamanca, ES	6
CICYTEXlocation not on record	5
Granada, ES	4
Wlocation not on record	4
Madrid, ES	3
Museo Achille Folettolocation not on record	3
Institut und Museum fuer Geologie und Palaeontologielocation not on record	2
Pamplona, ES	2
LDlocation not on record	1
Badajoz, ES	1
Madrid, ES	1
MeiseBGlocation not on record	1
Auckland, NZ	1
South Kensington, GB	1
Phyletisches Museum Jenalocation not on record	1
OLAlocation not on record	1
Henry Brockhouse Collectionlocation not on record	1

26 institutions · 266 of 266 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Simethis mattiazzii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Simethis mattiazzii

At a glance

Sources10 archives

Size & morphology3

Life cycle & reproduction3

Diet & foraging1

Habitat & environment6

Physiology & chemistry1

Other traits1

Compound class profile2 classes

Documented compounds2 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 638 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 26 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type2 638 records