Silphium asteriscus

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Silphium

At a glance

Occurrence records1 206

Data sources12

Biological traits8

DNA specimens1

eDNA detections6

Sources12 archives

Databases and archives Silphium asteriscus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 206 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources8 traits

Chemical compositionLOTUS · NPASS7 compounds

Occurrence & distributionGBIF1 206 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 14

01Narrative

Silphium asteriscus là một loài thực vật có hoa trong họ Cúc. Loài này được L. miêu tả khoa học đầu tiên năm 1753.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition7 compounds

Compounds documented for Silphium asteriscus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Humulane sesquiterpenoids3

Germacrane sesquiterpenoids1

Silphiperfolane sesquiterpenoids1

Bisabolane sesquiterpenoids1

Polyamines1

Documented compounds7 total

Tissue Source Quantified only

Compound	Amount	Source
(1E,6R,7R)-7-tert-butyl-1,6-dimethyl-5-methylidenecyclononene	present	LOTUS
2,6,6,9-Tetramethylcycloundeca-1,4,8-triene	present	LOTUS
7-epi-Silphiperfol-5-ene	present	LOTUS
Beta-Bisabolene	present	LOTUS
Humulene	present	LOTUS
Npc186905	present	LOTUS
Pyramidatine	present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Silphium asteriscus has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences10

eDNA detections6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF172010.1 ↗223 bp

ACGT

GATCGAAGCATCATCAAAAGACAACACATCATGGTATTTTACAAGTTTCATCACTCAAGAAGGATACCACACAACGCGAGACGACTGTCT …

Silphium asteriscus isolate Clevinger-414 internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS9

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Silphium asteriscus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome records14–142n range14median14mode11records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1411×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · eflora +1

CCDB · ipcn-api-dl — Xu, H. y., M. y. Chang & L. c. Tian. 1992. Studies on the karyotypes of 8 species in Silphium. Chin. Bull. Bot. 9(3): 47–49.

CCDB · book-ipcn67-71 — SETTLE, w. J. 1967. The chromosome morphology in the genus Silphium (Compositae). Ohio Jour. Sci. 67: 10-19.

CCDB · eflora

CCDB · book-fedorov — Fisher T. R., Crud en 1962

CCDB · book-fedorov — Fisher T. R., Cruden 1962

n 76×CCDB · book-ipcn67-71 · CCDB · Cave1962

CCDB · book-ipcn67-71 — JONES, S.B., JR. 1970. Chromosome numbers in Compositae. Bull. Torrey Bot. Club. 97: 168-174.

CCDB · book-ipcn67-71 — JONES, S.B. Jr. 1968. Chromosome numbers in southeastern United States Compositae I. Bull. Torrey Bot. Club 95: 393-395.

CCDB · Cave1962 — Fisher & Cruden 1962

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 206 records

Wild obs. + sensor936

Museum / vouchered270

Origin

Native4

Range

Area of Occupancy AOO3 536 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 616≤1 km 92≤10 km 25>10 km 86

819 georeferenced · 117 without coordinates

Open the mapobservation + sensor936

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 20≤1 km 28≤10 km 36>10 km 26

110 georeferenced · 160 without coordinates

Open the institutions mapphysical evidence270

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions32 of 49 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bangkok, TH	28
Tampa, US	27
Bronx, US	27
Chapel Hill, US	18
Jackson, US	17
Bloomington, US	14
Chongqing Museumlocation not on record	12
Columbia, US	11
Tall Timbers Research Stationlocation not on record	11
Valdosta State Universitylocation not on record	10
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	8
Fort Worth, US	7
Jena Microbial Resource Collectionlocation not on record	5
GAlocation not on record	4
Williamsburg, US	4
EL PASO, US	3
BAYLUlocation not on record	3
DOI/NPS, Mississippi National River & Recreation Arealocation not on record	3
Norfolk, US	3
Mississippi State, US	3
University of Tennessee at Chattanoogalocation not on record	3
Saint Louis, US	3
CJBGlocation not on record	2
Clemson, US	2
Tuscaloosa, US	2
China Agricultural Universitylocation not on record	2
Maryland Department of Natural Resourceslocation not on record	2
San Angelo, US	2
Wlocation not on record	2
Miami, US	2
University of Stellenboschlocation not on record	2
University of Southern Mississippilocation not on record	2
AUAlocation not on record	2
Philadelphia, US	2
Durham, US	1
Little Rock, US	1
Boise, US	1
Asheville, US	1
Podgorica, ME	1
Fairfax, US	1
Québec, CA	1
Lubbock, US	1
Phoenix, US	1
Knoxville, US	1
Richmond, US	1
Millersville, US	1
Burlington, US	1
Weber State Universitylocation not on record	1
US	1

49 institutions · 263 of 270 vouchered records shown · 7 without an institution code

09Environmental DNA6 detections

Where the DNA of Silphium asteriscus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.0 °C 19.3–27.2

Seasonal swing summer↔winter21.3 °C

Max temp (day)32.2 °C 25.3–32.7

Min temp (night)22.6 °C 15.2–23.0

Precipitation106 mm/mo 100–109

Air humidity59.2 % 57.4–60.2

Moisture balance-52.9 mm/mo -63.4–5.20

Vapour deficit1,400 Pa 967–1,475

Wind speed2.20 m/s 1.80–2.80

Cloud cover29.0 % 25.7–33.8

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Silphium asteriscus

At a glance

Sources12 archives

Life cycle & reproduction1

Diet & foraging1

Habitat & environment6

Compound class profile5 classes

Documented compounds7 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 206 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions32 of 49 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 206 records