Siler montanum

Crantz · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Apiales/Apiaceae/Siler

At a glance

Occurrence records850

Data sources8

Biological traits20

DNA specimens0

eDNA detections4

Sources8 archives

Databases and archives Siler montanum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility850 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~2.05 Gbp↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources20 traits

Chemical compositionLOTUS · NPASS25 compounds

Occurrence & distributionGBIF850 records

Environmental DNA1 datasets · 3 countries4 detections

DNA & barcodingNCBIsequences

Genome at a glanceGoaT2.1 Gbp

01Narrative

Le Sermontain ou Laser siler est une espèce de plantes à fleurs du genre Laserpitium et de la famille des Apiacées. C'est une plante herbacée vivace

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology6

Plant height0.45 m

Plant height max1 m

Plant height min0.3 m

Seed mass8.29 mg

Seed mass max7.19 mg

Seed mass min7.19 mg

Life cycle & reproduction7

Deciduousnessdeciduous

Dispersal type detailedanemochorous

Flowering endAug

Flowering startJun

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition25 compounds

Compounds documented for Siler montanum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Guaiane sesquiterpenoids14

Aporphine alkaloids $ Isoquinoline alkaloids2

Eudesmane sesquiterpenoids2

Germacrane sesquiterpenoids2

Aporphine alkaloids1

Documented compounds25 total

Tissue Source Quantified only

Compound	Amount	Source
(12S,13R)-16-methoxy-3,5-dioxa-11-azapentacyclo[10.7.1.02,6.08,20.014,19]icosa-1(20),2(6),7,14(19),15,17-hexaen-13-ol	present	NPASS
(1S,2S,4R,7E,11S,12S)-4,8,12-trimethyl-3,14-dioxatricyclo[9.3.0.02,4]tetradec-7-en-13-one	present	NPASS
(3S,8R,9S,10R,13R,14R,17R)-17-[(2R,5R)-5-ethyl-6-methylheptan-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	NPASS
2-Butenoic acid, 2-methyl-, (3S,3aR,4S,6S,6aS,9aS,9bS)-2,3,3a,4,5,6,6a,7,9a,9b-decahydro-6-hydroxy-3,6,9-trimethyl-2-oxoazuleno(4,5-b)furan-3,4-diyl ester, (2Z,2'Z)-	present	LOTUS
2-Butenoic acid, 2-methyl-, (3S,3aR,5aS,6R,9aR,9bS)-6-(acetyloxy)-2,3,3a,4,5,5a,6,7,9a,9b-decahydro-3,5a,9-trimethyl-2-oxonaphtho(1,2-b)furan-3-yl ester, (2Z)-	present	LOTUS
[(1R,2R)-1-(7-methoxy-1,3-benzodioxol-5-yl)-1-[(Z)-2-methylbut-2-enoyl]oxypropan-2-yl] (Z)-2-methylbut-2-enoate	present	LOTUS
[(3S,3aR,4R,6R,6aR,8S,9bS)-6-acetyloxy-3,3a-dihydroxy-3,6,9-trimethyl-8-[(E)-2-methylbut-2-enoyl]oxy-2-oxo-4,5,6a,7,8,9b-hexahydroazuleno[4,5-b]furan-4-yl] (2R)-2-methylbutanoate	present	LOTUS
[(3S,3aR,4S,6S,6aR,7S,9aS,9bS)-3,6-diacetyloxy-7-hydroxy-3,6,9-trimethyl-2-oxo-4,5,6a,7,9a,9b-hexahydro-3aH-azuleno[4,5-b]furan-4-yl] (E)-2-methylbut-2-enoate	present	LOTUS
[(3S,3aR,4S,6S,6aS,9aS,9bS)-3,6-diacetyloxy-3,6,9-trimethyl-2-oxo-4,5,6a,7,9a,9b-hexahydro-3aH-azuleno[4,5-b]furan-4-yl] (E)-2-methylbut-2-enoate	present	LOTUS
[(3S,3aR,4S,6S,6aS,9aS,9bS)-3,6-diacetyloxy-3,6,9-trimethyl-2-oxo-4,5,6a,7,9a,9b-hexahydro-3aH-azuleno[4,5-b]furan-4-yl] (Z)-2-methylbut-2-enoate	present	LOTUS

05DNA & barcoding6 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Siler montanum has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences6

eDNA detections4

Countries3

The DNA barcodea real sequence read deposited for this species

ITSFJ415113.1 ↗601 bpMontenegro

ACGT

TCGAATCCTGCGATAGCAGAATGACCCGTTAACACGTAAAAACATCGGGCAAGCGTCGGGGGGCCTTGTGTCCCCTGTTTGCAAACCCAA …

Siler montanum voucher Gardner & Gardner 2455 30-VII-1984 (E 00043177) internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS5

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Siler montanum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size2 053 800 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Siler montanum2.05 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type850 records

Wild obs. + sensor845

Museum / vouchered5

Range

Area of Occupancy AOO2 360 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 405≤1 km 91≤10 km 38>10 km 10

544 georeferenced · 301 without coordinates

Open the mapobservation + sensor845

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 1≤10 km 2

3 georeferenced · 2 without coordinates

Open the institutions mapphysical evidence5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sion, CH	2
GJOlocation not on record	1
Québec, CA	1
BIO-UNIPIlocation not on record	1

4 institutions · 5 of 5 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Siler montanum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.5 °C 7.30–15.1

Seasonal swing summer↔winter19.6 °C

Max temp (day)18.9 °C 11.0–19.9

Min temp (night)9.00 °C 1.80–9.30

Precipitation72.2 mm/mo 41.2–246

Air humidity58.3 % 53.9–60.7

Moisture balance-20.6 mm/mo -53.5–165

Vapour deficit782 Pa 474–919

Wind speed2.60 m/s 2.10–3.20

Cloud cover40.9 % 38.8–41.9

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)