Silene vallesia

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Caryophyllaceae/Silene

At a glance

Occurrence records1 852

Data sources10

Biological traits5

DNA specimens2

eDNA detections1

Sources10 archives

Databases and archives Silene vallesia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 852 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources5 traits

Occurrence & distributionGBIF1 852 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB · GoaT · TreeOfSex2n = 48

01Narrative

Silene vallesia, le Silène du Valais, est une espèce de plante herbacée vivace du genre Silene et de la famille des Caryophyllacées.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRY

Size & morphology2

Plant height0.1 m

Seed mass0.677 mg

Life cycle & reproduction2

Life formsubshrub

Life spanperennial

Habitat & environment1

Climatetemperate

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Silene vallesia has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKX450001.1 ↗757 bp

ACGT

GAAGGATCATTGTCGAAACCTGCCCAGCAGAGCGACCCGTGAACATGTTCAACCTCATGGGTGCTGGGGCGTTGCTCGGTGCCTCGTGTG …

Silene vallesia isolate S_val02 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1★ITS2

fungal barcode

06Genome at a glanceCCDB · GoaT · TreeOfSex

The complete instruction manual Silene vallesia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 48 n = 24

Ploidypolyploid inferred

Chromosome records24–482n range44median48mode12records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 486×CCDB · ita-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +1

CCDB · ita-fl — KUEPFER P. - 1974. Recherches sur les lieus de parent entre la flore orophile des Alpes et celle des Pyrnes.. Boissiera , 23: 1-322.

CCDB · ipcn-api-dl — Ghazanfar, S. A. 1983. Cytological studies in the genus Silene L. New Phytol. 93: 123–127.

CCDB · ipcn-api-dl — DEGRAEVE, N. 1980a. Etude de diverses particularites caryotypiques des genres Silene, Lychnis et Melandrium. Bol. Soc. Brot., sér. 2 2, 53: 595–643.

CCDB · book-ipcn67-71 — HESS, H.E.' E. LANDOLT, & R. HIRZEL. 1967. Flora der Schweiz und angrenzender Gebiete. Band I: Pteridophyte bis Caryophyllaceae. Birkhausen Verlag, Basel & Stuttgart. 858 pp.

CCDB · book-atlas-flowering-plants — 1942

2n 243×CCDB · ita-fl · CCDB · book-atlas-flowering-plants

CCDB · ita-fl — KUEPFER P. - 1974. Recherches sur les lieus de parent entre la flore orophile des Alpes et celle des Pyrnes.. Boissiera , 23: 1-322.

CCDB · ita-fl — GIORDANI A., MICELI P., MONTI G. - 1980. Numeri cromosomici per la flora italiana:789-793.. Inform. Bot. Ital. , 12(3): 327-332.

CCDB · book-atlas-flowering-plants

2n 403×GoaT · Tree of Sex Database · CCDB · ipcn-api-dl · TreeOfSex · plant

GoaT · Tree of Sex Database — ↗

CCDB · ipcn-api-dl — Micelli, P. & G. Monti. 1980. Numeri cromosomici per la Flora Italiana: 787-793. Inform. Bot. Ital. 12: 327–332.

TreeOfSex · plant — Goldblatt1979 ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 852 records

Wild obs. + sensor1 672

Museum / vouchered179

Cultivated / captive1

Origin

Introduced1

Range

Area of Occupancy AOO1 172 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy17% within 1 km

≤100 m 160≤1 km 106≤10 km 1 180>10 km 94

1 540 georeferenced · 132 without coordinates

Open the mapobservation + sensor1 672

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy11% within 1 km

≤100 m 3≤1 km 2≤10 km 37>10 km 3

45 georeferenced · 134 without coordinates

Open the institutions mapphysical evidence179

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zürich, CH	75
Zürich, CH	49
Bern, CH	15
BIO-UNIPIlocation not on record	6
Institut und Museum fuer Geologie und Palaeontologielocation not on record	5
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	4
Oskarshamn, SE	3
BClocation not on record	3
Dresden, DE	2
Karlsruhe, DE	2
Podgorica, ME	1
Porrentruy, CH	1
MAlocation not on record	1
Sion, CH	1
GJOlocation not on record	1
Fribourg, CH	1
Görlitz, DE	1
Bourges, FR	1
Wlocation not on record	1
Muséum Henri Lecoqlocation not on record	1

20 institutions · 174 of 179 vouchered records shown · 5 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Silene vallesia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Silene vallesia

At a glance

Sources10 archives

Size & morphology2

Life cycle & reproduction2

Habitat & environment1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 852 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions12 of 20 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type1 852 records