Silene tatarica

(L.) Pers. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Caryophyllaceae/Silene

At a glance

Occurrence records4 396

Data sources14

Biological traits25

DNA specimens8

eDNA detections5

Sources14 archives

Databases and archives Silene tatarica's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 396 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources25 traits

Chemical compositionLOTUS · NPASS10 compounds

Occurrence & distributionGBIF4 396 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD · NCBI8 specimens

Genome at a glanceCCDB · GoaT · TreeOfSex2n = 24

01Narrative

Silene tatarica, called the Tartarian catchfly, is a species of flowering plant in the genus Silene, found in north-central Europe and western Asia, from Germany and Norway eastwards to western Siberia and Kazakhstan. A specialist of riparian habitats, its seeds are dispersed by water.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology6

Plant height0.3 m

Plant height generative0.45 m

Plant height max1 m

Plant height min0.25 m

Seed length0.89 mm

Seed mass0.165 mg

Life cycle & reproduction9

Deciduousnessevergreen

Dispersal typeself

Flowering endAug

Flowering startMay

Life formperennial

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Self fertilizationpresent

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTforest, meadows, sand, sea

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Diaspore typeseed

03Chemical composition10 compounds

Compounds documented for Silene tatarica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Flavonols6

Ecdysteroids4

Documented compounds10 total

Tissue Source Quantified only

Compound	Amount	Source
(2S,3R,5R,9R,10R,13R,14R,17S)-2-hydroxy-10,13,14-trimethyl-17-[(2R,3R)-2,3,6-trihydroxy-6-methylheptan-2-yl]-3-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-[[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]oxan-2-yl]oxy-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta[a]phenanthren-6-one	present	LOTUS
(2S,3R,5R,9R,10R,13R,14S,17S)-2,14-dihydroxy-10,13-dimethyl-17-[(2R,3R)-2,3,6-trihydroxy-6-methylheptan-2-yl]-3-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-[[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]oxan-2-yl]oxy-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta[a]phenanthren-6-one	present	LOTUS
2-[3,4-dihydroxy-5-[(2R,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyphenyl]-5,7-dihydroxy-3-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-4-one	present	NPASS
2-[3,4-dihydroxy-5-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyphenyl]-5,7-dihydroxy-3-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-4-one	present	NPASS
20-Hydroxyecdysone	present	LOTUS
[(2R,3R)-3,6-dihydroxy-6-methyl-2-[(2S,3R,5R,9R,10R,13R,14S,17S)-2,3,14-trihydroxy-10,13-dimethyl-6-oxo-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta[a]phenanthren-17-yl]heptan-2-yl] benzoate	present	LOTUS
Hyperin	present	NPASS
Kaempferol	present	NPASS
Myricetin	present	NPASS
Quercetin 4'-O-galactoside	present	NPASS

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Silene tatarica has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes5

GenBank sequences2

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKP849855.1 ↗629 bp

ACGT

TCGAAACCTGCCCAGCAGAGCGACCCGTGAACATGTTCAACCTCATGGGTGCGGGGGCGTTGCTCGGTGCCTCGTGTGCCTGCTCGCCCC …

Silene tatarica internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcLa★ITS1★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · TreeOfSex

The complete instruction manual Silene tatarica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome records24–242n range24median24mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 245×GoaT · Tree of Sex Database · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +2

GoaT · Tree of Sex Database — ↗

CCDB · ipcn-api-dl — DEGRAEVE, N. 1980a. Etude de diverses particularites caryotypiques des genres Silene, Lychnis et Melandrium. Bol. Soc. Brot., sér. 2 2, 53: 595–643.

CCDB · book-ipcn67-71 — DAMBOLDT, J . & D. PHITOS. 1968. zur Cytotaxonomie einiger Arten der Gattung Silene L. (Caryophyllaceae). Verh. Bot. Ver. Prov. Brandenburg 105: 44-51.

CCDB · book-northern-plants — Rohweder 1939.

TreeOfSex · plant — Goldblatt1979 ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type4 396 records

Wild obs. + sensor3 357

Museum / vouchered1 035

Cultivated / captive1

Other3

Origin

Introduced1

Range

Area of Occupancy AOO7 676 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 1 959≤1 km 391≤10 km 378>10 km 186

2 914 georeferenced · 443 without coordinates

Open the mapobservation + sensor3 357

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 52≤1 km 121≤10 km 309>10 km 214

696 georeferenced · 339 without coordinates

Open the institutions mapphysical evidence1 035

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 44 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	250
Helsinki, FI	158
Oulu, FI	101
Uniwersytet Wrocławskilocation not on record	56
Turku, FI	49
Adam Mickiewicz University in Poznańlocation not on record	43
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	38
LDlocation not on record	35
Kuopio, FI	33
Uppsala, SE	14
Oskarshamn, SE	13
Bergen, NO	11
Tartu, EE	11
TROMlocation not on record	9
Jyväskylä, FI	7
Uniwersytet Warszawskilocation not on record	6
BRNUlocation not on record	6
Berlin, DE	5
Trondheim, NO	4
Philadelphia, US	4
BClocation not on record	4
SLU Artdatabankenlocation not on record	4
Finnish Museum of Natural Historylocation not on record	3
MeiseBGlocation not on record	3
TUR-Alocation not on record	3
Porvoo, FI	3
Institut und Museum fuer Geologie und Palaeontologielocation not on record	3
Tula State Lev Tolstoy Pedagogical Universitylocation not on record	3
Görlitz, DE	2
Wlocation not on record	2
Stockholm, SE	2
Prioksko-Terrasnyi Biosphere Reservelocation not on record	2
Rovaniemi, FI	2
Beijing, CN	2
Bronx, US	2
NMBU:MINAlocation not on record	2
Columbia, US	1
MAlocation not on record	1
Uniwersytet Jagiellońskilocation not on record	1
Kandalaksha State Nature Reservelocation not on record	1
BGBMlocation not on record	1
Tromso University Museumlocation not on record	1
Uniwersytet Śląski w Katowicachlocation not on record	1
Universidad del Pais Vasco (UPV/EHU)location not on record	1

44 institutions · 903 of 1 035 vouchered records shown · 126 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Silene tatarica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.4 °C 14.0–16.9

Seasonal swing summer↔winter23.7 °C

Max temp (day)19.0 °C 16.1–20.3

Min temp (night)13.2 °C 9.80–14.3

Precipitation90.7 mm/mo 85.7–96.6

Air humidity60.6 % 59.9–62.2

Moisture balance-13.0 mm/mo -36.2–0.7

Vapour deficit723 Pa 620–772

Wind speed3.00 m/s 2.70–3.80

Cloud cover48.5 % 44.0–61.5

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Silene tatarica

At a glance

Sources14 archives

Size & morphology6

Life cycle & reproduction9

Diet & foraging1

Habitat & environment7

Physiology & chemistry1

Other traits1

Compound class profile2 classes

Documented compounds10 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type4 396 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions19 of 44 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 396 records