Silene tamaranae — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Caryophyllaceae/Silene

At a glance

Occurrence records13

Data sources4

Biological traits14

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Silene tamaranae's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility13 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources14 traits

Occurrence & distributionGBIF13 records

DNA & barcodingNCBIsequences

01Narrative

Silene tamaranae is a species of plant in the Caryophyllaceae family. The species is native to the Canary Islands.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology1

Plant height max1 m

Life cycle & reproduction5

Dehiscencedehiscent

Flower colourwhite

Flowering endJul

Flowering startApr

Life spanperennial

Habitat & environment7

Climatesubtropical

Elevation max1 500 m

Elevation min500 m

Fruit typecapsule

Growth formshrub

Leaf formelliptic

Woodinessvariable

Other traits1

Leaf arrangementrosette

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Silene tamaranae has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKX757500.1 ↗646 bpSpain

ACGT

TCGAAACCTGCCCAGCAGAGCGACCCGTGAACATGTTCAACCTCATGGGTGCTGGGGCGTTGCTCGGTGCCTTGTGTGCCGGCTCGCCCC …

Silene tamaranae voucher Arnoldo Santos Guerra 30/11/2003 ORT internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1rbcL1ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type13 records

Wild obs. + sensor13

Range

Area of Occupancy AOO32 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤1 km 9≤10 km 4

13 georeferenced

Open the mapobservation + sensor13

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.