Silene sytnikii — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Caryophyllaceae/Silene

At a glance

Occurrence records68

Data sources7

Biological traits1

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Silene sytnikii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility68 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF68 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Silene sytnikii is a species of flowering plant in the family Caryophyllaceae, native to Ukraine. Known from only a few locales along the Southern Bug river, it is very similar to Silene frivaldskyana.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVP

Habitat & environment1

Climatetemperate

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Silene sytnikii has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMH329676.1 ↗692 bpUkraine · 2004

ACGT

ACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAGCGACCCGTGAACATGTTCAACCTCATGGGTGCTGGGGCGTTGTTCGGTGCC …

Silene sytnikii voucher KW080657 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

08Occurrence & distribution

Record type68 records

Wild obs. + sensor10

Museum / vouchered58

Range

Area of Occupancy AOO52 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 6≤1 km 2

8 georeferenced · 2 without coordinates

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤1 km 3≤10 km 1

4 georeferenced · 54 without coordinates

Open the institutions mapphysical evidence58

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA1 detections

Where the DNA of Silene sytnikii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.