Silene sedoides

Poir. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Caryophyllaceae/Silene

At a glance

Occurrence records1 953

Data sources10

Biological traits14

DNA specimens7

eDNA detections14

Sources10 archives

Databases and archives Silene sedoides's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 953 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF1 953 records

Environmental DNA1 datasets · 1 countries14 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB · GoaT · TreeOfSex2n = 24

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology2

Plant height0.1 m

Seed mass0.043 mg

Life cycle & reproduction3

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Silene sedoides has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes2

GenBank sequences10

eDNA detections14

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPP824390.1 ↗488 bpIraq · 2023

ACGT

TCACGCATCGCGTCTCCCCCAAACCCACCTCGAGTGGAGGGGAAGGAGGATGGTCTCCCGTGACTCACCGGTCACGGCTGGCCTAAAATT …

Silene sedoides strain Aljaf-M14 internal transcribed spacer 2 and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS2

fungal barcode

06Genome at a glanceCCDB · GoaT · TreeOfSex

The complete instruction manual Silene sedoides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome records24–242n range24median24mode10records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 2410×GoaT · Tree of Sex Database · CCDB · iber-fl · CCDB · ipcn-api-dl +3

GoaT · Tree of Sex Database — ↗

CCDB · iber-fl — Studies on the flora of the Balearic Islands, I. Dahlgren, R., Th. Karlsson & P. Lassen.Bot. Not.124: 249-269(1971).

CCDB · ipcn-api-dl — Montmollin, B. d. 1986. étude cytotaxonomique de la flore de la Crète. III. Nombres chromosomiques. Candollea 41: 431–439.

CCDB · ipcn-api-dl — Runemark, H. 1996. Mediterranean chromosome number reports 6 (590--678). Fl. Medit. 6: 223–243.

CCDB · book-ipcn73-74 — BARI, E.A. 1973. Cytological studies in the genus Silene L. New Phytol. 72: 833-838.

CCDB · book-ipcn73-74 — DAHLGREN, R., TH. KARLSSON, & P. LASSEN. 1971. Studies on the flora I < the Balearic Islands. I. Chromosome numbers in Balearic angiosperms. sot. Notiser 124: 249~269.

CCDB · CromoCat 2015 — Dahlgren, R., Karlsson, Th. & Lassen, P. (1971). Studies on the Flora of the Balearic Islands, I. Chromosome numbers in Balearic Angiosperms. Bot. Not. 124(1): 249-269.

CCDB · CromoCat 2015 — Montmollin, B. de. (1986). Étude cytotaxonomique de la flore de la Crète. III. Nombres chromosomiques. Candollea 41: 431-439.

CCDB · CromoCat 2015 — Runemark, H. (1996). Mediterranean chromosome number reports-6 Fl. Medit. 6: 223-243.

TreeOfSex · plant — Goldblatt1979 ↗

n 123×CCDB · ipcn-api-dl · CCDB · CromoCat 2015 · TreeOfSex · plant

CCDB · ipcn-api-dl — Montmollin, B. d. 1986. étude cytotaxonomique de la flore de la Crète. III. Nombres chromosomiques. Candollea 41: 431–439.

CCDB · CromoCat 2015 — Montmollin, B. de. (1986). Étude cytotaxonomique de la flore de la Crète. III. Nombres chromosomiques. Candollea 41: 431-439.

TreeOfSex · plant — Goldblatt1979 ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 953 records

Wild obs. + sensor1 578

Museum / vouchered360

Other15

Origin

Native1

Range

Area of Occupancy AOO2 024 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy15% within 1 km

≤100 m 147≤1 km 37≤10 km 974>10 km 101

1 259 georeferenced · 319 without coordinates

Open the mapobservation + sensor1 578

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy76% within 1 km

≤100 m 14≤1 km 20≤10 km 11

45 georeferenced · 315 without coordinates

Open the institutions mapphysical evidence360

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LDlocation not on record	181
Paris, FR	59
Berlin, DE	19
MAlocation not on record	11
València, ES	7
UIBlocation not on record	7
Institut und Museum fuer Geologie und Palaeontologielocation not on record	6
College of the Atlantic, Museumlocation not on record	5
BDBClocation not on record	5
BClocation not on record	4
Alicante, ES	4
Wlocation not on record	4
JBSlocation not on record	3
Provincia di Livornolocation not on record	3
Salamanca, ES	3
GJOlocation not on record	3
Sevilla, ES	3
Barcelona, ES	3
Stockholm, SE	3
Frankfurt am Main	3
Tilburg, NL	2
Universidad del Pais Vasco (UPV/EHU)location not on record	2
Salzburg, AT	2
Xiamen, CN	2
Granada, ES	2
CJBGlocation not on record	1
BSBIlocation not on record	1
Moscow State Universitylocation not on record	1
Podgorica, ME	1
Jaén, ES	1
Rishon Le Zion, IL	1

31 institutions · 352 of 360 vouchered records shown · 8 without an institution code

09Environmental DNA14 detections

Where the DNA of Silene sedoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.0 °C 17.0–17.0

Seasonal swing summer↔winter16.2 °C

Max temp (day)18.5 °C

Min temp (night)14.9 °C

Precipitation55.2 mm/mo

Air humidity62.8 %

Moisture balance-51.6 mm/mo

Vapour deficit758 Pa

Wind speed3.00 m/s

Cloud cover38.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Silene sedoides

At a glance

Sources10 archives

Size & morphology2

Life cycle & reproduction3

Diet & foraging1

Habitat & environment6

Physiology & chemistry1

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 953 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions16 of 31 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 953 records