Silene oropediorum

Coss. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Caryophyllaceae/Silene

At a glance

Occurrence records41

Data sources4

Biological traits6

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Silene oropediorum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility41 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources6 traits

Occurrence & distributionGBIF41 records

DNA & barcodingNCBIsequences

01Narrative

Silene oropediorum là loài thực vật có hoa thuộc họ Cẩm chướng. Loài này được Coss. miêu tả khoa học đầu tiên năm 1890.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formannual

Life spanannual

Raunkiær life formtherophyte

Habitat & environment3

Climatesubtropical

Growth formherb

Woodinessnon-woody

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Silene oropediorum has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences3

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPV940166.1 ↗703 bpMorocco · 1990

ACGT

TCGAAACCTGCCCAGCAGAGCGACCCGTGAACACGTACAACCTCGTGGGTGTTGGGCCGTTGCTCGGTACCTCGTGTGCCGGCTCGTCCC …

Silene oropediorum isolate 7235 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3

fungal barcode

08Occurrence & distribution

Record type41 records

Wild obs. + sensor16

Museum / vouchered25

Origin

Native3

Range

Area of Occupancy AOO120 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 1≤1 km 7≤10 km 4

12 georeferenced · 4 without coordinates

Open the mapobservation + sensor16

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 13

14 georeferenced · 11 without coordinates

Open the institutions mapphysical evidence25

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	7
València, ES	5
Granada, ES	4
MAlocation not on record	2
Madrid, ES	1
Phyletisches Museum Jenalocation not on record	1
Museo Achille Folettolocation not on record	1
Entomological Society of Latvialocation not on record	1
College of the Atlantic, Museumlocation not on record	1

9 institutions · 23 of 25 vouchered records shown · 2 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)