Sida cordifolia
speciesAt a glance
Occurrence records9 746
Data sources13
Biological traits48
DNA specimens35
eDNA detections18
Sources13 archives
Databases and archives Sida cordifolia's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility9 746 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics35 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources48 traits
Chemical compositionLOTUS · NPASS171 compounds
Occurrence & distributionGBIF9 746 records
Environmental DNA1 datasets · 4 countries18 detections
DNA & barcodingBOLD · NCBI35 specimens
Genome at a glanceCCDB · GIFT2n = 28
01Narrative
心叶黄花稔（学名：）为锦葵科黄花稔属下的一个种。原生於印度，現於全球野化。
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRY
Size & morphology21
Fruit length3.5 mm
Fruit length max3.5 mm
Fruit length min2.8 mm
Fruit width6.25 mm
Leaf length40 mm
⚠ sources differ — AusTraits: 40 mm · GIFT: 32.5 mm
Leaf length max100 mm
Leaf length min10 mm
Leaf width30 mm
Leaf width max40 mm
Leaf width min10 mm
Petiole length4.5 cm
Plant height0.95 m
⚠ sources differ — GIFT: 0.95 m · AusTraits: 2 m · TRY: 0.75 m
Plant height max1.52 m
Plant height min0.05 m
Seed length3 mm
Seed length max2.3 mm
Seed length min1.8 mm
Seed mass3.97 mg
⚠ sources differ — TRY: 3.97 mg · AusTraits: 3.99 mg · GIFT: 2.59 mg
Seed mass max4.46 mg
Seed mass min1.11 mg
Seed width1 mm
Life cycle & reproduction10
Dehiscencedehiscent
Dispersal typeanimal
Flowering endDec
Flowering startDec
Flowering timeyyyyyyyyynny
Life formannual or subshrub
Life spanannual/perennial
⚠ sources differ — TRY: annual/perennial · AusTraits: perennial · GIFT: perennial
Pollination syndromeinsect
Raunkiær life formtherophyte
Resprouting capacityresprouts
Diet & foraging1
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max2 520 m
Elevation min0 m
Epiphyteterrestrial
Fruit typeschizocarp
⚠ sources differ — AusTraits: schizocarp · GIFT: nut
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: shrub · TRY: Shrub
Habitat GIFT-
Leaf compoundnesssimple
Leaf shapeovate widely_ovate
Mycorrhiza typearbuscular
Succulenceno
Woodinessvariable
⚠ sources differ — TRY: non-woody/woody · AusTraits: woody · GIFT: non-woody
Physiology & chemistry2
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
03Chemical composition171 compounds
Compounds documented for Sida cordifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Friedelane triterpenoids15
Lupane triterpenoids15
Megastigmanes10
Oleanane triterpenoids9
Cinnamic acids and derivatives7
Documented compounds171 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-8-Methoxyisolariciresinol | present | NPASS | |
| (+)-Abscisic acid beta-D-glucopyranosyl ester | present | NPASS | |
| (+)-Erythrodiol | present | NPASS | |
| (+)-Lyoniresinol | present | NPASS | |
| (+)-Ursolic Acid | present | NPASS | |
| (-)-Isolariciresinol | present | NPASS | |
| (-)-Pseudoephedrine | present | LOTUS | |
| (-)-Vasicine | present | NPASS | |
| (1R,2R,4aS,6aR,6aR,6bR,8aR,10S,12aR,14aR,14bS)-1,2,4a,6a,6b,9,9,12a-octamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14,14a,14b-hexadecahydropicene-2,10-diol | present | NPASS | |
| (1R,3aR,5aR,5bR,7aR,11aR,11bR,13aR,13bR)-1-[(2R)-1-hydroxypropan-2-yl]-3a,5a,5b,8,8,11a-hexamethyl-2,3,4,5,6,7,7a,10,11,11b,12,13,13a,13b-tetradecahydro-1H-cyclopenta[a]chrysen-9-one | present | NPASS |
05DNA & barcoding35 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sida cordifolia has left across the world's sequence archives.
At a glance
DNA specimens35
Marker genes7
GenBank sequences10
eDNA detections18
Countries4
The DNA barcodea real sequence read deposited for this species
GGACGGTTGGGAAAATTCTGAAGTCTTTGAACGCAAGTTGCGCCCCAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCG …
Sida cordifolia partial ITS2 gene for Internal Transcribed Spacer 5, isolate Seq4
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK4★rbcL3★rbcLa★trnL-F★ITS3★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GIFT
The complete instruction manual Sida cordifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 28 n = 14
Ploidypolyploid inferred
Chromosome records28–322n range28median28mode6records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 284×CCDB · ipcn-api-dl · CCDB · book-fedorov · GIFT · GIFT (floras)
CCDB · ipcn-api-dl — Ugborogho, R. E. 1982a. Cytological studies on six species of Sida L. in Nigeria. Bol. Soc. Brot. 55: 157–165.
CCDB · ipcn-api-dl — Cheng, Y. f. & J. l. Tsai. 1999. Chromosome study of the Malvaceae in Taiwan. Quart. J. Forest Res. 21(3): 61–72.
CCDB · book-fedorov — Skovsted 1941
GIFT · GIFT (floras)
2n 322×CCDB · book-ipcn67-71 · GIFT · GIFT (floras)
CCDB · book-ipcn67-71 — HAZRA, R., & A. SHARMA. 1971. Chromosome studies in different species and varieties of Sida with special reference to accessory chromosome. Cytologia 36~85-297.
GIFT · GIFT (floras)
n 81×CCDB · iapt
CCDB · iapt — IAPT/IOPB Chromosome Data 12
n 141×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Sidhu, M. K., R. C. Gupta & N. Goyal. 1990. SOCGI plant chromosome number reports---IX. J. Cytol. Genet. 25: 145.
n 211×CCDB · iapt
CCDB · iapt — IAPT/IOPB Chromosome Data 21
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type9 746 records
Wild obs. + sensor4 318
Museum / vouchered4 385
Cultivated / captive3
Other1 040
Origin
Native800
Introduced129
Range
Area of Occupancy AOO23 888 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy84% within 1 km
≤100 m 1 845≤1 km 259≤10 km 134>10 km 258
2 496 georeferenced · 1 822 without coordinates
Open the mapobservation + sensor4 318
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy57% within 1 km
≤100 m 444≤1 km 134≤10 km 341>10 km 99
1 018 georeferenced · 3 367 without coordinates
Open the institutions mapphysical evidence4 385
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 3 records without
Open the mapnot free-living3
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions119 of 286 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Brisbane, AU | 326 |
| Saint Louis, US | 271 |
| Bronx, US | 252 |
| Palmerston, AU | 125 |
| Canberra, AU | 95 |
| Laboratorio de Ictiologialocation not on record | 83 |
| LaCarto/IGATE/UAClocation not on record | 81 |
| MeiseBGlocation not on record | 81 |
| Durango, MX | 80 |
| UFBAlocation not on record | 79 |
| Chicago, US | 76 |
| University of Stellenboschlocation not on record | 72 |
| Tampa, US | 64 |
| JBRJlocation not on record | 60 |
| UNIVASFlocation not on record | 55 |
| Mexico City, MX | 55 |
| Paleontological Collectionlocation not on record | 52 |
| Smithfield, AU | 50 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 50 |
| Sydney, AU | 49 |
| Chaguaramas, TT | 48 |
| Paris, FR | 47 |
| Instituto do Meio Ambientelocation not on record | 47 |
| Taipei, TW | 46 |
| Feira de Santana, BR | 43 |
| National Museum of Natural Sciencelocation not on record | 43 |
| UFPElocation not on record | 42 |
| Université de Strasbourglocation not on record | 41 |
| Adelaide, AU | 39 |
| Masindi, UG | 39 |
| Museo Entomologico de Leonlocation not on record | 36 |
| Istituto Agrario Castelnuovolocation not on record | 36 |
| Durban, ZA | 35 |
| Guangzhou, CN | 35 |
| Beijing, CN | 35 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 34 |
| Kew, GB | 33 |
| Baroda, IN | 33 |
| Cenargenlocation not on record | 32 |
| Corrientes, AR | 29 |
| Universidade Federal de Sergipe (UFS)location not on record | 29 |
| Salvador, BR | 28 |
| Mérida, MX | 27 |
| TAIElocation not on record | 26 |
| Adam Mickiewicz University in Poznańlocation not on record | 24 |
| Departamento de Sistematica e Ecologialocation not on record | 24 |
| Mount Annan, AU | 23 |
| Austin, US | 23 |
| HNBlocation not on record | 23 |
| Kunming, CN | 23 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 21 |
| Brasília, BR | 21 |
| Taipei, TW | 20 |
| Guilin, CN | 20 |
| Universidad Nacional de Colombia (UNAL)location not on record | 20 |
| Miami, US | 19 |
| CEPLAClocation not on record | 18 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 18 |
| UFESlocation not on record | 17 |
| Mexico City, MX | 16 |
| Federal University of Espírito Santolocation not on record | 16 |
| UnBlocation not on record | 16 |
| Honolulu, US | 15 |
| Córdoba, AR | 15 |
| Kensington, AU | 15 |
| Xiamen, CN | 15 |
| Frankfurt am Main | 15 |
| UFMGlocation not on record | 14 |
| University of Papua New Guinealocation not on record | 14 |
| St. Augustine, TT | 14 |
| UFRPElocation not on record | 13 |
| LSF/FSA/UAClocation not on record | 13 |
| Taipei, TW | 13 |
| UFMSlocation not on record | 13 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 13 |
| Cusco, PE | 12 |
| WAGlocation not on record | 12 |
| Pretoria, ZA | 12 |
| Bogotá, D.C., CO | 12 |
| Fundación Desarrollo y Ambiente FUNDAlocation not on record | 11 |
| Museu Paraense Emílio Goeldilocation not on record | 11 |
| Kathmandu, NP | 11 |
| UFERSAlocation not on record | 10 |
| FUNEDlocation not on record | 10 |
| Fortaleza, BR | 10 |
| IPA/SPlocation not on record | 10 |
| UNESP-FCAlocation not on record | 9 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 9 |
| Centre National de la Recherche Scientifique et Technologique / Institut de l'environnement et de recherches agricoleslocation not on record | 9 |
| Pondicherry, IN | 9 |
| Chengdu, CN | 9 |
| Universidad Nacional de Asunciónlocation not on record | 9 |
| San Isidro, AR | 9 |
| USP-IBlocation not on record | 9 |
| UESBlocation not on record | 8 |
| INMAlocation not on record | 8 |
| MAlocation not on record | 8 |
| Nagasaki University - Fisherieslocation not on record | 8 |
| HACAMlocation not on record | 8 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 8 |
| CPATSAlocation not on record | 8 |
| Santa Cruz de la Sierra, BO | 8 |
| UNESP-ISlocation not on record | 8 |
| Universiti Sains Malaysialocation not on record | 8 |
| TAFORI-LSRClocation not on record | 7 |
| Brasília, BR | 7 |
| Yunnan Universitylocation not on record | 7 |
| CJBGlocation not on record | 7 |
| Chengdu, CN | 7 |
| UEMlocation not on record | 7 |
| Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record | 7 |
| James Cook Townsvillelocation not on record | 7 |
| Yaoundé, CM | 7 |
| Instituto de Investigação Científica Tropicallocation not on record | 7 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 6 |
| BISHlocation not on record | 6 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 6 |
| UTFPR-CPlocation not on record | 6 |
| León, NI | 6 |
| Université du Lomélocation not on record | 6 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 6 |
| URCAlocation not on record | 6 |
| UFSJlocation not on record | 6 |
| South Kensington, GB | 6 |
| John T. Waterhouse Herbariumlocation not on record | 5 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 5 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 5 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 5 |
| Campo Mourão, BR | 5 |
| Guatemala City, GT | 5 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 5 |
| Aarhus, DK | 5 |
| Ivano-Frankivsk, UA | 5 |
| Plocation not on record | 5 |
| Foz do Iguaçu, BR | 4 |
| Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record | 4 |
| Armidale, AU | 4 |
| Dehra Dun, IN | 4 |
| Leiden University Medical Centerlocation not on record | 4 |
| CNF-UFHBlocation not on record | 4 |
| Universidad Pedagógica y Tecnológica de Colombia (UPTC)location not on record | 4 |
| HUT Culture Collectionlocation not on record | 4 |
| Stockholm, SE | 4 |
| UEMAlocation not on record | 4 |
| Sucre, BO | 4 |
| Cruz das Almas, BR | 4 |
| Burlington, US | 4 |
| GZUlocation not on record | 4 |
| Chongqing Museumlocation not on record | 4 |
| Uppsala, SE | 4 |
| Ilhéus, BR | 4 |
| Sri Ramaswamy Memorial Universitylocation not on record | 3 |
| Philadelphia, US | 3 |
| Auckland, NZ | 3 |
| Riverside, US | 3 |
| Antiguo Cuscatlán, SV | 3 |
| Centre National de Floristique - Université Félix HOUPHOUËT-BOIGNYlocation not on record | 3 |
| Universidade Federal do Oeste da Bahialocation not on record | 3 |
| FPMZBlocation not on record | 3 |
| ASUlocation not on record | 3 |
| Berlin, DE | 3 |
| Universidade Federal do Maranhãolocation not on record | 3 |
| Universidad de Nariño (UdeNar)location not on record | 3 |
| EL PASO, US | 3 |
| UFPRlocation not on record | 3 |
| Institut fur Allgemeine Mikrobiologielocation not on record | 3 |
| Uniwersytet Jagiellońskilocation not on record | 3 |
| Iquitos, PE | 3 |
| Castelar, AR | 3 |
| HUENFlocation not on record | 3 |
| Altos de Pipe, VE | 3 |
| Seoul, KR | 3 |
| Claremont, US | 3 |
| Bloomington, US | 3 |
| University of Zhejianglocation not on record | 2 |
| Blumenau, BR | 2 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 2 |
| University of California at Berkeleylocation not on record | 2 |
| UNICAMPlocation not on record | 2 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 2 |
| Maringá, BR | 2 |
| Chapel Hill, US | 2 |
| Fredericksburg, US | 2 |
| Centre National des Semences Forestièreslocation not on record | 2 |
| Cambridge University Herbariumlocation not on record | 2 |
| LEA/FSA/UAClocation not on record | 2 |
| Herbier National du Gabonlocation not on record | 2 |
| Cambridge, US | 2 |
| Christchurch, NZ | 2 |
| Montecillo, Texcoco, MX | 2 |
| Université National du Béninlocation not on record | 2 |
| Tuscaloosa, US | 2 |
| Changsha, CN | 2 |
| Calabar, NG | 2 |
| National Natural History Collectionslocation not on record | 2 |
| Hobart, AU | 2 |
| UEPAlocation not on record | 2 |
| UNITINSlocation not on record | 2 |
| Fort Worth, US | 2 |
| València, ES | 2 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 2 |
| Arusha, TZ | 1 |
| UTFPR-SLlocation not on record | 1 |
| Conservatoire Botanique National de Mascarinlocation not on record | 1 |
| LISClocation not on record | 1 |
| Göteborg, SE | 1 |
| MEXUlocation not on record | 1 |
| Universidad de Antioquia (UdeA)location not on record | 1 |
| PACA, Mlocation not on record | 1 |
| ILLSlocation not on record | 1 |
| Ann Arbor, US | 1 |
| Londrina, BR | 1 |
| Coimbra, PT | 1 |
| LDlocation not on record | 1 |
| Macomb, US | 1 |
| INBIOlocation not on record | 1 |
| UFSCarlocation not on record | 1 |
| UFAClocation not on record | 1 |
| UFABClocation not on record | 1 |
| UNESClocation not on record | 1 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 1 |
| Mississippi State, US | 1 |
| Universidade Federal de Pelotaslocation not on record | 1 |
| Mexico City, MX | 1 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 1 |
| Nijmegen, NL | 1 |
| IECOSlocation not on record | 1 |
| Universidade Federal de Goiáslocation not on record | 1 |
| ESALQlocation not on record | 1 |
| Montréal, CA | 1 |
| Tuxtla Gutiérrez, MX | 1 |
| Goucher Collegelocation not on record | 1 |
| Moscow State Universitylocation not on record | 1 |
| South China Normal Universitylocation not on record | 1 |
| Universidad de la Amazonia (UniAmazonia)location not on record | 1 |
| Post Graduate College Bannulocation not on record | 1 |
| GAlocation not on record | 1 |
| Pontifícia Universidade Católica do Paranálocation not on record | 1 |
| Elocation not on record | 1 |
| Chadron, US | 1 |
| Pontifícia Universidade Católica do Paranálocation not on record | 1 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 1 |
| Mérida, MX | 1 |
| Yangling, CN | 1 |
| US | 1 |
| Cape Town, ZA | 1 |
| University of Johannesburglocation not on record | 1 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 1 |
| Edward O. Wilson Biodiversity Laboratory, Gorongosa NPlocation not on record | 1 |
| Beijing Normal Universitylocation not on record | 1 |
| Qarshi Botanical Gardenlocation not on record | 1 |
| Quito, EC | 1 |
| BAYLUlocation not on record | 1 |
| GMBAlocation not on record | 1 |
| Eduardo Mondlane Universitylocation not on record | 1 |
| Tempe, US | 1 |
| San Francisco de Campeche, MX | 1 |
| Chongqing Natural History Museumlocation not on record | 1 |
| La Paz, BO | 1 |
| Dresden, DE | 1 |
| Cochabamba, BO | 1 |
| UFPIlocation not on record | 1 |
| Université de Bordeauxlocation not on record | 1 |
| Jataí / Setor Industrial, BR | 1 |
| MUFALlocation not on record | 1 |
| Loja, EC | 1 |
| UNESP, Campus São José Rio Prêtolocation not on record | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| Wlocation not on record | 1 |
| Tapachula, MX | 1 |
| Universidade Federal de Pernambucolocation not on record | 1 |
| Edinburgh, GB | 1 |
| LBVlocation not on record | 1 |
| PUC-RSlocation not on record | 1 |
| Institute for Agricultural Research of Mozambiquelocation not on record | 1 |
| BRLUlocation not on record | 1 |
| Universidade Federale do Rio Grande do Sullocation not on record | 1 |
| Ural Federal University "B. N. Yeltsin"location not on record | 1 |
| Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record | 1 |
| EFGlocation not on record | 1 |
| Institut de Biologia Evolutiva, (CSIC-UPF)location not on record | 1 |
| North-West University, A.P. Goossens Herbariumlocation not on record | 1 |
| Swami Ramanand Teerth Marathwada Universitylocation not on record | 1 |
| IFANlocation not on record | 1 |
| Teresina, BR | 1 |
| Glocation not on record | 1 |
286 institutions · 4 212 of 4 385 vouchered records shown · 172 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA18 detections
Where the DNA of Sida cordifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found18
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 18 detections have coordinates
Open the map4 countries0
Forest
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median25.1 °C 20.7–27.1
Seasonal swing summer↔winter12.5 °C
Max temp (day)29.6 °C 26.1–30.5
Min temp (night)19.3 °C 15.6–23.9
Precipitation109 mm/mo 15.3–240
Air humidity54.5 % 52.0–65.7
Moisture balance-17.8 mm/mo -77.7–101
Vapour deficit1,340 Pa 1,041–1,616
Wind speed2.10 m/s 1.80–3.30
Cloud cover25.2 % 11.4–31.5
CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.