Sida acuta
Burm.fil. · speciesAt a glance
Occurrence records15 913
Data sources15
Biological traits61
DNA specimens36
eDNA detections270
Sources15 archives
Databases and archives Sida acuta's data was compiled from.
WikipediaWikimedia Foundation6 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility15 887 records↗
OBISOcean Biodiversity Information System26 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI270 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics36 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources61 traits
Chemical compositionLOTUS · NPASS40 compounds
Occurrence & distributionGBIF · OBIS15 913 records
Environmental DNA2 datasets · 6 countries270 detections
DNA & barcodingBOLD · NCBI36 specimens
Genome at a glanceCCDB · GIFT2n = 28
01Narrative
Sida acuta, the common wireweed, is a species of flowering plant in the mallow family, Malvaceae. It is believed to have originated in Central America, but today has a pantropical distribution and is considered a weed in some areas. In northern Australia, Sida acuta is considered an invasive species, and the beetle Calligrapha pantherina has been introduced as a biological control agent in an attempt to control the plant.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRY
Size & morphology22
Fruit length4.5 mm
⚠ sources differ — AusTraits: 4.5 mm · GIFT: 3.5 mm
Fruit length max4 mm
Fruit length min1 mm
Fruit width4.5 mm
Leaf length55 mm
⚠ sources differ — AusTraits: 55 mm · GIFT: 35 mm
Leaf length max100 mm
Leaf length min10 mm
Leaf width12.5 mm
⚠ sources differ — AusTraits: 12.5 mm · GIFT: 7 mm
Leaf width max42 mm
Leaf width min4 mm
Petiole length0.35 cm
Plant height1.17 m
⚠ sources differ — GIFT: 1.17 m · AusTraits: 1 m · TRY: 0.51 m
Plant height max2 m
Plant height min0.25 m
Seed length max2.7 mm
Seed length min1.7 mm
Seed mass2.41 mg
Seed mass max3.1 mg
Seed mass min1.95 mg
Seed width1.6 mm
Seed width max1.7 mm
Seed width min1.3 mm
Life cycle & reproduction15
Deciduousnessevergreen
Dehiscencedehiscent
Dispersal typeunspecialized
Flower colouryellow
Flower length max8 mm
Flower length min6 mm
Flower width max15 mm
Flower width min2.8 mm
Flowering endMay
Flowering startMar
Flowering timennnnnyyynnnn
Life formannual or subshrub
Life spanannual
⚠ sources differ — TRY: annual · AusTraits: perennial · GIFT: perennial
Raunkiær life formchamaephyte
Resprouting capacityresprouts
Diet & foraging1
Parasiteindependent
Habitat & environment13
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max1 400 m
Elevation min0 m
Epiphyteterrestrial
Fruit typeschizocarp
Growth formshrub
⚠ sources differ — GIFT: shrub · AusTraits: herb shrub · TRY: Herb
Habitat GIFT-
Leaf formlanceolate
Leaf shapelanceolate narrowly_lanceolate oblong ovate
Succulenceno
Woodinessvariable
⚠ sources differ — TRY: non-woody/woody · AusTraits: herbaceous woody · GIFT: variable
Physiology & chemistry7
Leaf dry-matter content (LDMC)331 mg/g
Leaf n20 mg/g
Leaf p2 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Specific leaf area (SLA)28.6 mm²/mg
Wood density453 mg/cm³
Other traits3
Seed height max0.15 mm
Seed height min0.11 mm
Shoot orientationerect
03Chemical composition40 compounds
Compounds documented for Sida acuta across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Acridone alkaloids5
Prenyl quinone meroterpenoids4
Kavalactones and derivatives3
Apocarotenoids(ε-)3
Acetogenins3
Documented compounds40 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Annonacin | present | NPASS | |
| (2R)-4-[(2S,13R)-2,13-dihydroxy-13-[(2R,5R)-5-[(1R)-1-hydroxytridecyl]oxolan-2-yl]tridecyl]-2-methyl-2H-furan-5-one | present | NPASS | |
| (2R)-4-[(8R,13R)-8,13-dihydroxy-13-[(2S,5R)-5-[(1S)-1-hydroxytridecyl]oxolan-2-yl]tridecyl]-2-methyl-2H-furan-5-one | present | NPASS | |
| (2S)-2-[(1R,2S)-1,2-dihydroxy-2-phenylethyl]-2,3-dihydropyran-6-one | present | NPASS | |
| (2S)-5-hydroxy-7-[(1S,2S)-2-hydroxy-2-[(2S)-6-oxo-2,3-dihydropyran-2-yl]-1-phenylethoxy]-2-phenyl-2,3-dihydrochromen-4-one | present | NPASS | |
| (2S,5R,9S)-9-Acetyl-9-hydroxy-2,7,8-trimethyl-2-((4R,8R)-4,8,12-trimethyltridecyl)-1-oxaspiro[4.4]non-7-en-6-one | present | LOTUS | |
| (3R,3aR,6R,6aS)-3,6-bis(4-hydroxy-3-methoxyphenyl)-3,3a,6,6a-tetrahydro-1H-furo[3,4-c]furan-4-one | present | NPASS | |
| (4S,6S)-6-[(1S,2S)-1,2-dihydroxy-2-phenylethyl]-4-hydroxyoxan-2-one | present | NPASS | |
| (6R,9S)-vomifoliol | present | NPASS | |
| (S)-evofolin-A | present | NPASS |
05DNA & barcoding36 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sida acuta has left across the world's sequence archives.
At a glance
DNA specimens36
Marker genes7
GenBank sequences10
eDNA detections270
Countries6
The DNA barcodea real sequence read deposited for this species
GGGGTACCGGGAACGAATCGAGTTCTTTGAACGCAAGTTGCGCCCCAAGCCATTAGGCCGAGGCCCACGTTCTGCCTGGGTGTCACGCAT …
Sida acuta partial ITS2 gene for Internal Transcribed Spacer 15, isolate Seq 14
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL7★rbcLa★trnL-F★ITS3★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GIFT
The complete instruction manual Sida acuta carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 28 n = 14
Ploidy2× diploid · measured
Chromosome records14–7142n range28median28mode23records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2816×CCDB · book-ipcn65 · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +2
CCDB · book-ipcn65 — Mangenot & M. 1962
CCDB · ipcn-api-dl — Scott Emuakpor, M. B. & R. E. Ugborogho. 1980. Cytogenetic studies on Sida species in Nigeria: Sida acuta complex, S. garekeana and S. scabrida. Bol. Soc. Brot., sér. 2 2, 53: 443–463.
CCDB · ipcn-api-dl — Krishnappa, D. G. & Munirajappa. 1982. In IOPB chromosome number reports LXXVI. Taxon 31: 582–583.
CCDB · ipcn-api-dl — Carvalheira, G. M. G., M. Guerra, G. A. d. Santos, V. C. d. Andrade & M. C. A. d. Farias. 1991. Citogenética de angiospermas coletadas em Pernambuco---IV. Acta Bot. Brasil. 5(2): 37–51.
CCDB · ipcn-api-dl — Cheng, Y. f. & J. l. Tsai. 1999. Chromosome study of the Malvaceae in Taiwan. Quart. J. Forest Res. 21(3): 61–72.
CCDB · ipcn-api-dl — Noor, S. S., S. S. Deen, L. Ahmed, R. Begum, M. A. Zaman & S. S. Alam. 2003. Differential fluororecent chromosome banding of four Sida spp. (Malvaceae). Cytologia 68: 25–30.
CCDB · ipcn-api-dl — Fernández, A., A. Krapovickas, G. Lavia & G. Seijo. 2003. Chromosomas de Malváceas. Bonplandia (Corrientes) 12(1–4): 141–145.
CCDB · book-ipcn67-71 — ADHIKARY, A.K. 1963. Cytotaxonomical studies in some species of Sida. Trans. Bose Res. Inst. 26: 59-84
CCDB · book-ipcn67-71 — HARVEY, M.J. 1967. In IOPB chromosome number reports IX. Taxon 16: 62-66.
CCDB · book-fedorov — Sinha R. P. 1962
CCDB · book-fedorov — Ad.hikary 1963
CCDB · book-fedorov — Ford 1938
CCDB · book-fedorov — Harvey M. (C. n. IX. 1967)
GIFT · GIFT (floras)
2n 145×CCDB · book-ipcn67-71 · CCDB · book-fedorov · GIFT · GIFT (floras)
CCDB · book-ipcn67-71 — KRAPOVICKAS, A. 1967. Notas citotaxonomicas sobre Malveae. Kurtziana 4: 29-37.
CCDB · book-ipcn67-71 — KOOTIN-SANWU, M. 1969. In IOPB chromosome number reports XXII. Taxon 18: 433-442.
CCDB · book-fedorov — Skovsted 1935
CCDB · book-fedorov — Raghavan R. S., Arora 1958
GIFT · GIFT (floras)
2n 181×GIFT · GIFT (floras)
GIFT · GIFT (floras)
2n 7141×CCDB · Cave1958
CCDB · Cave1958 — Raghavan & Arora 1958
n 145×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71
CCDB · ipcn-api-dl — Scott Emuakpor, M. B. & R. E. Ugborogho. 1980. Cytogenetic studies on Sida species in Nigeria: Sida acuta complex, S. garekeana and S. scabrida. Bol. Soc. Brot., sér. 2 2, 53: 443–463.
CCDB · ipcn-api-dl — Sidhu, M. K., R. C. Gupta & N. Goyal. 1990. SOCGI plant chromosome number reports---IX. J. Cytol. Genet. 25: 145.
CCDB · book-ipcn67-71 — BAQUAR, S.R. 1967-68. Chromosome numbers in some vascular plants of East Pakistan. Rev. Biol. 6: 440-448.
n 71×CCDB · Cave1958
CCDB · Cave1958 — Raghavan & Arora 1958
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type15 913 records
Wild obs. + sensor9 274
Museum / vouchered6 364
Other275
Origin
Native199
Introduced198
Range
Area of Occupancy AOO28 180 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy78% within 1 km
≤100 m 2 348≤1 km 363≤10 km 585>10 km 202
3 498 georeferenced · 5 776 without coordinates
Open the mapobservation + sensor9 274
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy75% within 1 km
≤100 m 1 690≤1 km 211≤10 km 492>10 km 131
2 524 georeferenced · 3 840 without coordinates
Open the institutions mapphysical evidence6 364
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions132 of 311 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Durango, MX | 676 |
| Mexico City, MX | 555 |
| LaCarto/IGATE/UAClocation not on record | 402 |
| Saint Louis, US | 284 |
| Brisbane, AU | 218 |
| Bronx, US | 211 |
| Palmerston, AU | 165 |
| Mérida, MX | 131 |
| Mexico City, MX | 131 |
| Austin, US | 103 |
| University of Stellenboschlocation not on record | 98 |
| MeiseBGlocation not on record | 96 |
| Taipei, TW | 95 |
| Canberra, AU | 88 |
| Kew, GB | 83 |
| Sydney, AU | 75 |
| Universidad Nacional de Colombia (UNAL)location not on record | 63 |
| Beijing, CN | 55 |
| Paris, FR | 52 |
| Smithfield, AU | 51 |
| Universidad de Caldas (UCaldas)location not on record | 49 |
| Taipei, TW | 45 |
| Museo Entomologico de Leonlocation not on record | 45 |
| Universidad de Antioquia (UdeA)location not on record | 42 |
| Kunming, CN | 41 |
| MEXUlocation not on record | 39 |
| Adelaide, AU | 37 |
| Kensington, AU | 36 |
| Tuxtla Gutiérrez, MX | 36 |
| Guangzhou, CN | 36 |
| INBIOlocation not on record | 36 |
| Chicago, US | 35 |
| Baroda, IN | 35 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 32 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 32 |
| TAIElocation not on record | 32 |
| Tapachula, MX | 31 |
| Miami, US | 31 |
| Riverside, US | 31 |
| Berlin, DE | 30 |
| Guilin, CN | 29 |
| St. Augustine, TT | 28 |
| Chapingo, MX | 27 |
| WAGlocation not on record | 27 |
| Antiguo Cuscatlán, SV | 27 |
| Culiacán, MX | 26 |
| Leiden University Medical Centerlocation not on record | 26 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 26 |
| Frankfurt am Main | 25 |
| Adam Mickiewicz University in Poznańlocation not on record | 25 |
| Tuxtla Gutiérrez, MX | 24 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 24 |
| Masindi, UG | 24 |
| San Francisco de Campeche, MX | 22 |
| Kathmandu, NP | 22 |
| IBANNlocation not on record | 20 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 19 |
| Puerto Ayora, EC | 19 |
| Xiamen, CN | 19 |
| Mount Annan, AU | 18 |
| Honolulu, US | 18 |
| Auckland, NZ | 17 |
| Universidade Federal de Sergipe (UFS)location not on record | 17 |
| LBVlocation not on record | 16 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 16 |
| MAlocation not on record | 15 |
| Austin, US | 15 |
| UNIVASFlocation not on record | 14 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 14 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 13 |
| Ciudad de México, MX | 13 |
| Herbier National du Gabonlocation not on record | 12 |
| Altos de Pipe, VE | 12 |
| Laboratorio de Ictiologialocation not on record | 12 |
| Jena Microbial Resource Collectionlocation not on record | 11 |
| Instituto do Meio Ambientelocation not on record | 11 |
| Chaguaramas, TT | 11 |
| Plocation not on record | 10 |
| Tampa, US | 10 |
| Taipei, TW | 10 |
| University of Papua New Guinealocation not on record | 10 |
| Juriquilla, MX | 10 |
| TAFORI-LSRClocation not on record | 10 |
| Aarhus, DK | 9 |
| Chongqing Museumlocation not on record | 9 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 9 |
| UFPElocation not on record | 9 |
| Universidad Pedagógica y Tecnológica de Colombia (UPTC)location not on record | 9 |
| Brussels, BE | 8 |
| JBRJlocation not on record | 8 |
| Autlán de Navarro, MX | 8 |
| Seychelles National Herbariumlocation not on record | 8 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 8 |
| UFBAlocation not on record | 8 |
| La Paz, MX | 8 |
| Christchurch, NZ | 8 |
| Universidad de Nariño (UdeNar)location not on record | 8 |
| Université du Lomélocation not on record | 7 |
| EL PASO, US | 7 |
| Chengdu, CN | 7 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 7 |
| San Diego, US | 7 |
| Edinburgh, GB | 7 |
| ASUlocation not on record | 6 |
| National Biodiversity Institute, Costa Ricalocation not on record | 6 |
| Dresden, DE | 6 |
| Nishihara, JP | 6 |
| James Cook Townsvillelocation not on record | 6 |
| BMlocation not on record | 6 |
| Mérida, MX | 6 |
| Universidad de La Salle (La Salle)location not on record | 6 |
| Durban, ZA | 6 |
| Pondicherry, IN | 6 |
| Fortaleza, BR | 6 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 6 |
| Moscow State Universitylocation not on record | 5 |
| Uppsala, SE | 5 |
| San José, CR | 5 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 5 |
| John T. Waterhouse Herbariumlocation not on record | 5 |
| CASlocation not on record | 5 |
| Cenargenlocation not on record | 5 |
| Instituto de Investigação Científica Tropicallocation not on record | 5 |
| Uniwersytet Śląski w Katowicachlocation not on record | 5 |
| Yaoundé, CM | 5 |
| Conservatoire Botanique National de Mascarinlocation not on record | 5 |
| Universidade Federal do Maranhãolocation not on record | 5 |
| Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record | 5 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 4 |
| Tuscaloosa, US | 4 |
| Mexico City, MX | 4 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 4 |
| Universidad Distrital Francisco José de Caldas (UDistrital)location not on record | 4 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 4 |
| Feira de Santana, BR | 4 |
| Elocation not on record | 4 |
| Universidad de la Amazonia (UniAmazonia)location not on record | 4 |
| Guangzhou, CN | 4 |
| Pretoria, ZA | 4 |
| HNBlocation not on record | 4 |
| Fort Worth, US | 4 |
| Departamento de Sistematica e Ecologialocation not on record | 3 |
| Forestry Research Institute of Nigerialocation not on record | 3 |
| LISClocation not on record | 3 |
| Fundación Desarrollo y Ambiente FUNDAlocation not on record | 3 |
| Cuiabá, BR | 3 |
| Wlocation not on record | 3 |
| Universidad Tecnológica del Chocó (UTCH)location not on record | 3 |
| Institut fur Allgemeine Mikrobiologielocation not on record | 3 |
| Gujarat Biodiversity Gene Banklocation not on record | 3 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 3 |
| CNF-UFHBlocation not on record | 3 |
| University of Hamburglocation not on record | 3 |
| Wuhan, CN | 3 |
| Istituto Agrario Castelnuovolocation not on record | 3 |
| South Kensington, GB | 3 |
| Sri Ramaswamy Memorial Universitylocation not on record | 3 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 3 |
| Escuela Agrícola Panamericanalocation not on record | 3 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 3 |
| Sociedad Para el Estudio de los Recursos Bioticos de Oaxacalocation not on record | 3 |
| LDlocation not on record | 3 |
| Stockholm, SE | 3 |
| Guatemala City, GT | 3 |
| UESBlocation not on record | 2 |
| Departamento de Geologia, Universidad de Chilelocation not on record | 2 |
| Universidad del Tolima (UT)location not on record | 2 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 2 |
| USP-IBlocation not on record | 2 |
| Flagstaff, US | 2 |
| Davis, US | 2 |
| Dehra Dun, IN | 2 |
| Clocation not on record | 2 |
| Addis Ababa, ET | 2 |
| Botanic Gardenlocation not on record | 2 |
| CMULlocation not on record | 2 |
| National Natural History Collectionslocation not on record | 2 |
| Hobart, AU | 2 |
| Provincia di Livornolocation not on record | 2 |
| Mexico City, MX | 2 |
| HACAMlocation not on record | 2 |
| Wuzhou, CN | 2 |
| BGPAlocation not on record | 2 |
| Universidad Industrial de Santander (UIS)location not on record | 2 |
| Centre National de la Recherche Scientifique et Technologique / Institut de l'environnement et de recherches agricoleslocation not on record | 2 |
| Cambridge University Herbariumlocation not on record | 2 |
| Changsha, CN | 2 |
| Uniwersytet Jagiellońskilocation not on record | 2 |
| Llocation not on record | 2 |
| Tlalnepantla, MX | 2 |
| Nishihara, JP | 2 |
| Loja, EC | 2 |
| National Institute of Biological Resourceslocation not on record | 2 |
| Fredericksburg, US | 2 |
| Beijing, CN | 2 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 2 |
| Museu Paraense Emílio Goeldilocation not on record | 2 |
| UTPLlocation not on record | 2 |
| Edward O. Wilson Biodiversity Laboratory, Gorongosa NPlocation not on record | 2 |
| XALlocation not on record | 2 |
| Zapopan, MX | 2 |
| DSMlocation not on record | 2 |
| EAlocation not on record | 2 |
| Université de Bordeauxlocation not on record | 2 |
| Universidad Católica de Oriente (UCO)location not on record | 2 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 2 |
| Pontifícia Universidade Católica do Paranálocation not on record | 2 |
| UEMAlocation not on record | 2 |
| València, ES | 2 |
| IECOSlocation not on record | 2 |
| Armidale, AU | 2 |
| UFPRlocation not on record | 2 |
| CJBGlocation not on record | 2 |
| Goucher Collegelocation not on record | 2 |
| HUENFlocation not on record | 2 |
| Durham, US | 1 |
| UFERSAlocation not on record | 1 |
| Montecillo, Texcoco, MX | 1 |
| Tempe, US | 1 |
| INMAlocation not on record | 1 |
| Vancouver, CA | 1 |
| GAlocation not on record | 1 |
| Universidade do Estado de Mato Grossolocation not on record | 1 |
| Vietnam Academy of Science and Technology (VAST)location not on record | 1 |
| Jardín Botánico de Cartagena “Guillermo Piñeres”location not on record | 1 |
| IFANlocation not on record | 1 |
| Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record | 1 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 1 |
| Servico de Microbiologia e Imunologialocation not on record | 1 |
| Giardini Botanici Hanburylocation not on record | 1 |
| Universidade Federal do Oeste da Bahialocation not on record | 1 |
| Tomioka, JP | 1 |
| Universidade Federal de Santa Catarinalocation not on record | 1 |
| Toronto, CA | 1 |
| Ciudad de México, MX | 1 |
| LGlocation not on record | 1 |
| Limbe Botanical & Zoological Gardenslocation not on record | 1 |
| Station d'Ecologie de Lamtolocation not on record | 1 |
| Burlington, US | 1 |
| HEMlocation not on record | 1 |
| Université National du Béninlocation not on record | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| University of Johannesburglocation not on record | 1 |
| Rishon Le Zion, IL | 1 |
| Zhuzhou, CN | 1 |
| Phoenix, US | 1 |
| Madison, US | 1 |
| Mazatlán, MX | 1 |
| Maringá, BR | 1 |
| Bloomington, US | 1 |
| Clemson, US | 1 |
| Fundación Miguel Lillolocation not on record | 1 |
| Universidad de Guayaquillocation not on record | 1 |
| Yangling, CN | 1 |
| Eduardo Mondlane Universitylocation not on record | 1 |
| Wuhan, CN | 1 |
| BAlocation not on record | 1 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 1 |
| Yunnan Universitylocation not on record | 1 |
| Corrientes, AR | 1 |
| Zürich, CH | 1 |
| EMTCMlocation not on record | 1 |
| LERF/FA/UPlocation not on record | 1 |
| Alcaldía Municipal de Garzón en Huilalocation not on record | 1 |
| Santa Cruz de la Sierra, BO | 1 |
| UFMGlocation not on record | 1 |
| Quito, EC | 1 |
| Universidad de El Salvadorlocation not on record | 1 |
| UFOPlocation not on record | 1 |
| Museum of Zoologylocation not on record | 1 |
| Centre National de Floristique - Université Félix HOUPHOUËT-BOIGNYlocation not on record | 1 |
| Entomological Society of Latvialocation not on record | 1 |
| Nanyue Arboretumlocation not on record | 1 |
| BISHlocation not on record | 1 |
| BRLUlocation not on record | 1 |
| Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record | 1 |
| Ojo, NG | 1 |
| UNISANTAlocation not on record | 1 |
| University of Zhejianglocation not on record | 1 |
| Centre for Medicinal Plants Research-Arya Vaidya Salalocation not on record | 1 |
| Museo de Historia Natural de El Salvadorlocation not on record | 1 |
| Salamanca, ES | 1 |
| Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahualocation not on record | 1 |
| University of Santo Tomas Herbariumlocation not on record | 1 |
| LSFlocation not on record | 1 |
| Minia, EG | 1 |
| Cincinnati, US | 1 |
| Pullman, US | 1 |
| UEPAlocation not on record | 1 |
| Provo, US | 1 |
| Santiago de Cali, CO | 1 |
| UPNlocation not on record | 1 |
| Hanshan Normal Universitylocation not on record | 1 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 1 |
| Millersville, US | 1 |
| Nnamdi Azikiwe University Herbarium (NAUH)location not on record | 1 |
| Centre National de Semences Forestièreslocation not on record | 1 |
| Cambridge, US | 1 |
| Helsinki, FI | 1 |
| Londrina, BR | 1 |
| San Francisco, US | 1 |
| Ivano-Frankivsk, UA | 1 |
| Universidade Federale do Rio Grande do Sullocation not on record | 1 |
| URCAlocation not on record | 1 |
| HUAlocation not on record | 1 |
| Philadelphia, US | 1 |
| UNESP-RClocation not on record | 1 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 1 |
| UnBlocation not on record | 1 |
| San Luis Potosí, MX | 1 |
| North-West University, A.P. Goossens Herbariumlocation not on record | 1 |
311 institutions · 5 752 of 6 364 vouchered records shown · 591 without an institution code
09Environmental DNA270 detections
Where the DNA of Sida acuta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found270
Studies independent surveys2
Countries6
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 270 detections have coordinates
Open the map6 countries0
Floodplain/Thicket
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median21.0 °C 17.2–21.1
Seasonal swing summer↔winter12.3 °C
Max temp (day)25.9 °C 21.6–25.9
Min temp (night)16.1 °C 13.5–16.2
Precipitation166 mm/mo 126–167
Air humidity60.1 % 58.7–61.4
Moisture balance22.7 mm/mo 9.90–39.0
Vapour deficit1,019 Pa 754–1,021
Wind speed4.00 m/s 3.50–4.70
Cloud cover35.6 % 35.6–36.6
CHELSA 1981–2010, ~9 km grid, at location & month of 268 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.