Shiraia bambusicola

Henn. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Dothideomycetes/Pleosporales/Shiraiaceae/Shiraia

At a glance

Occurrence records590

Data sources12

Biological traits0

DNA specimens8

eDNA detections582

Sources12 archives

Databases and archives Shiraia bambusicola's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility590 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI582 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS11 compounds

Occurrence & distributionGBIF590 records

Environmental DNA4 datasets · 6 countries582 detections

DNA & barcodingBOLD · NCBI8 specimens

Genome at a glanceGoaT · NCBI≈33 Mbp

01Narrative

Shiraia bambusicola is a parasitic fungus on twigs of several genera of bamboos, and its relatively large stromata are used in traditional Chinese medicine. It is the sole species in the monotypic genus Shiraia. It is widely distributed in many provinces of Southern China and also in Japan. The genus Shiraia, named after Dr. Mitsutaro Shirai, was first established and proposed as a member of the family Nectriaceae by P. Hennings in 1900. Although the familial placement is somewhat uncertain, molecular phylogenetic evidence based on the sequences of ribosomal DNA supports its positioning in the Phaeosphaeriaceae. The extracts from its stromata contain hypocrellins and shiraiachromes, members of perylenequinone class of natural products, which are photoactivated therapeutic agents. Hypocrellins were firstly found in another filamentous fungus Hypocrella bambuase, which is also parasitic on bamboos.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition11 compounds

Compounds documented for Shiraia bambusicola across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Anthraquinones and anthrones4

Bisnaphthalenes1

Documented compounds11 total

Tissue Source Quantified only

Compound	Amount	Source
(12S,13R)-12-acetyl-9,13,17-trihydroxy-5,10,16,21-tetramethoxy-13-methylpentacyclo[13.8.0.02,11.03,8.018,23]tricosa-1(15),2(11),3(8),5,9,16,18(23),20-octaene-4,7,19,22-tetrone	present	LOTUS
(9,17-Dihydroxy-5,10,16,21-tetramethoxy-13-methyl-7,19-dioxo-12-hexacyclo[13.8.0.02,11.03,8.04,22.018,23]tricosa-1(15),2(11),3(8),4(22),5,9,12,16,18(23),20-decaenyl) acetate	present	LOTUS
HYGKPGOEWCYHEN-ROPCXPMJSA-N	present	NPASS
Hypocrellin a	present	LOTUS
Hypocrellin B	present	LOTUS
Hypocrellin C	present	LOTUS
Hypocrellin D	present	LOTUS
Shiraiachrome A	present	LOTUS

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Shiraia bambusicola has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes2

GenBank sequences10

eDNA detections582

Countries6

The DNA barcodea real sequence read deposited for this species

ITSMT852333.1 ↗263 bp

ACGT

AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCAAAACACACGACCTGGGGAGTTTCTGAACAAGAAACCCCCCG …

Shiraia bambusicola isolate F-caf-cas311 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10

animal barcodefungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Shiraia bambusicola carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈33 075 958 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Shiraia bambusicola0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type590 records

Wild obs. + sensor2

Museum / vouchered588

Range

Area of Occupancy AOO1 168 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 1 without coordinates

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 1≤10 km 1>10 km 1

3 georeferenced · 585 without coordinates

Open the institutions mapphysical evidence588

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Catholic University of Pekinglocation not on record	4
Odawara, JP	3
TENN-Flocation not on record	2
Pullman, US	1
Ilvolocation not on record	1
DPIlocation not on record	1
Bernard Price Institute for Palaeontological Researchlocation not on record	1

7 institutions · 13 of 588 vouchered records shown · 574 without an institution code

09Environmental DNA582 detections

Where the DNA of Shiraia bambusicola was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found582

Studies independent surveys4

Countries6

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 582 detections have coordinates

Open the map6 countries0

North Sea

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature17.0 °C 9.00–35.0

pH6.40 3.80–9.60

Conductivity80.0 µS/cm 10.0–86,000

Organic carbon1.50 % 0.005–13.8

Water content8.90 % 0.363–74.4

Nitrate-N6.00 mg/kg 0.5–470

Phosphorus17.0 mg/kg 2.00–590

Clay15.9 % 0.445–71.7

Sand70.3 % 1.00–97.1

Depth0 m 0–0.9

MarineSoilFerrosolDermosolTenosolsChromosolsKandosolSodosol

542 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.0 °C 11.8–23.4

Seasonal swing summer↔winter13.5 °C

Max temp (day)20.1 °C 16.5–30.1

Min temp (night)10.4 °C 6.80–17.8

Precipitation49.0 mm/mo 17.9–82.2

Air humidity56.0 % 45.7–60.0

Moisture balance-72.5 mm/mo -148–10.1

Vapour deficit786 Pa 584–1,595

Wind speed3.60 m/s 2.50–4.80

Cloud cover20.9 % 11.3–30.3

CHELSA 1981–2010, ~9 km grid, at location & month of 575 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)