Shinnersia rivularis

(A.Gray) R.M.King & H.Rob. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Shinnersia

At a glance

Occurrence records93

Data sources9

Biological traits10

DNA specimens4

eDNA detections4

Sources9 archives

Databases and archives Shinnersia rivularis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility93 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF93 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 60

01Narrative

Shinnersia rivularis, known as the Rio Grande bugheal or Mexican oak leaf plant, is an aquatic plant native to Texas, Coahuila, and Nuevo León. It is classified in tribe Eupatorieae within family Asteraceae.King, Robert Merrill & Robinson, Harold Ernest. 1970. Phytologia 19(5): 297–298Tropicos, Shinnersia R.M. King & H. Rob.Flann, C (ed) 2009+ Global Compositae ChecklistBiota of North America Program 2013 county distribution map It is thought to be related to two other aquatic genera in this tribe, Sclerolepis and Trichocoronis. The roots live in the muck at the bottom of shallow slow-moving water (for example, along a stream), and the stem extends above the water slightly (less than 10 centimetres). Shinnersia is a common freshwater aquarium plant, and can sometimes be found having escaped cultivation. The genus is named in honor of Lloyd H. Shinners of the Southern Methodist University.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction2

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Shinnersia rivularis has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences7

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKJ637176.1 ↗650 bpUSA

ACGT

TCGAATCCTGCATAGCAGAACAACCTGTGAACATGTTACAACAAGATGGCTTGGCGGGGGCTTGATGCTTTTGTTTCAAACCTTGTTAAG …

Shinnersia rivularis voucher Schilling & Panero 04-08 (TENN) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Shinnersia rivularis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 60 n = 30

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 601×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Turner, B. L. & Z. Zhao. 1992. Documented chromosome numbers 1992: 2. Miscellaneous U.S.A. and Mexican species, mostly Asteraceae. Sida 15: 147–150.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

07Deep time~3.5 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin3.5 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type93 records

Wild obs. + sensor64

Museum / vouchered28

Other1

Range

Area of Occupancy AOO112 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 30≤1 km 14≤10 km 2>10 km 2

48 georeferenced · 16 without coordinates

Open the mapobservation + sensor64

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 6≤1 km 3

9 georeferenced · 19 without coordinates

Open the institutions mapphysical evidence28

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	8
Mexico City, MX	4
Austin, US	4
Wlocation not on record	3
Kew, GB	2
GZUlocation not on record	2
Flagstaff, US	1
Salzburg, AT	1
MeiseBGlocation not on record	1
Canadian Department of Agriculturelocation not on record	1
Whitewater, US	1

11 institutions · 28 of 28 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Shinnersia rivularis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)