Sherardia arvensis
speciesAt a glance
Occurrence records174 442
Data sources13
Biological traits66
DNA specimens36
eDNA detections24
Sources13 archives
Databases and archives Sherardia arvensis's data was compiled from.
WikipediaWikimedia Foundation12 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility174 442 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics36 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources66 traits
Occurrence & distributionGBIF174 442 records
Environmental DNA2 datasets · 7 countries24 detections
DNA & barcodingBOLD · NCBI36 specimens
Genome at a glanceCCDB · GoaT · NCBI587 Mbp
01Narrative
Sherardia is a monotypic genus of flowering plants in the family Rubiaceae. The genus contains only one species, viz. Sherardia arvensis or (blue) field madder, which is widespread across most of Europe and northern Africa as well as southwest and central Asia (from Turkey to Saudi Arabia to Kazakhstan) and Macaronesia (Canary Islands, Azores, Madeira, Savage Islands). It is also reportedly naturalized in Australia, New Zealand, Taiwan, Kerguelen, Ethiopia, Sudan, southern Africa, Mexico, Costa Rica, South America, Bermuda, Cuba, Haiti and much of Canada and the United States (especially the Pacific States and the lower Mississippi Valley).Kew World Checklist of Selected Plant Families, Sherardia arvensisAltervista Flora Italiana, Sherardia arvensisBiota of North America Program, Galium sherardia (synonym of Sherardia arvensis)
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology23
Fruit length2.5 mm
⚠ sources differ — AusTraits: 2.5 mm · GIFT: 2 mm
Fruit length max2.5 mm
Fruit length min2 mm
Leaf length10 mm
Leaf length max17 mm
Leaf length min4 mm
Leaf mass0.546 mg
Leaf mass per area79.81 g/m2
Leaf size32 mm²
⚠ sources differ — TRY: 32 mm² · AusTraits: 32.76 mm² · LEDA: 12.5 mm² · GIFT: 12.5 mm²
Leaf width3 mm
⚠ sources differ — AusTraits: 3 mm · GIFT: 2 mm
Leaf width max5 mm
Leaf width min1.5 mm
Plant height0.181 m
⚠ sources differ — GIFT: 0.181 m · AusTraits: 0.038 m · LEDA: 0.125 m · TRY: 0.125 m
Plant height generative0.125 m
Plant height max0.4 m
Plant height min0.05 m
Seed length2.85 mm
Seed mass1.75 mg
⚠ sources differ — TRY: 1.75 mg · AusTraits: 1.66 mg · LEDA: 1.78 mg · GIFT: 1.69 mg
Seed mass max1.89 mg
Seed mass min1.45 mg
Seed volume1.5 mm³
Seed volume max1.5 mm³
Seed volume min1.5 mm³
Life cycle & reproduction17
Deciduousnesshibernal
⚠ sources differ — TRY: hibernal · GIFT: deciduous
Dispersal typeanimal
⚠ sources differ — LEDA: epizoochor · GIFT: unspecialized
Flower width max5 mm
Flower width min4 mm
Flowering endJun
Flowering startApr
Flowering timennnnnnnnyyyy
Life formannual
Life spanannual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Reproduction asexualabsent
Seed number50
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment15
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max3 400 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessfleshy
Fruit typemericarp
Growth formherb
Habitat GIFTcropfields,forestedges,mountains,oldfields,parks
Leaf compoundnesssimple
Leaf formelliptic
Leaf shapeelliptical lanceolate obovate
Mycorrhiza type0.0000000376
Woodinessnon-woody
Physiology & chemistry5
Leaf dry-matter content (LDMC)184 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)22.67 mm²/mg
⚠ sources differ — TRY: 22.67 mm²/mg · LEDA: 23.9 mm²/mg · GIFT: 22.47 mm²/mg
Other traits4
Diaspore typemericarp with appendage
Leaf arrangementwhorled
Plant support typefree-standing
Seeds per fruit101-1000
05DNA & barcoding36 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sherardia arvensis has left across the world's sequence archives.
At a glance
DNA specimens36
Marker genes6
GenBank sequences10
eDNA detections24
Countries7
The DNA barcodea real sequence read deposited for this species
GTGAATCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCACCCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCCCGTCGTCGCA …
Sherardia arvensis voucher PLT.0185 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL2★rbcLa★trnL-F★ITS8★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Sherardia arvensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size586 800 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Sherardia arvensis0.59 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 22 n = 11
Ploidydiploid inferred
Chromosome records22–222n range22median22mode43records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2243×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · slov-fl · CCDB · brit-fl +10
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · slov-fl — Májovský J. et al., 1970b: Index of chromosome numbers of Slovakian flora Part 2. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 18: 45-60.
CCDB · brit-fl — Wentworth, J.E., Bailey, J.P., Gornall, R.J. Watsonia 18: 415-418 (1991)
CCDB · iber-fl — Notas cariolgicas em Rubiaceae portuguesas. Queirs, M.Bol. Soc. Brot. ser. 259: 233-243(1987).
CCDB · iber-fl — Cytotaxonomy of spanish plants. IV.-Dicotyledons: Caesalpinacea-Asteracea. Lve, A. & E. Kjellqvist.Lagascalia4(2): 153-211(1974).
CCDB · iber-fl — Nmeros cromossmicos para a flora portuguesa, 104-115. Queirs, M.Bol. Soc. Brot. ser. 264: 135-142(1991).
CCDB · iber-fl — Studies on the flora of the Balearic Islands, I. Dahlgren, R., Th. Karlsson & P. Lassen.Bot. Not.124: 249-269(1971).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3771
CCDB · fl-europaea — Skalinska et al.
CCDB · poland — Skali?ska M. et al. 1964. Additions to chromosome numbers of Polish Angiosperms (Fifth contribution). Acta Soc. Bot. Pol. 33, 45-76.
CCDB · ipcn-api-dl — Queirós, M. 1987. Notas cariológicas em Rubiaceae Portuguesas. Bol. Soc. Brot., sér. 2 59: 233–243.
CCDB · ipcn-api-dl — Queirós, M. 1986. Notas cariológicas em Rubiaceae Portuguesas. Bol. Soc. Brot., sér. 2 59: 233–243.
CCDB · ipcn-api-dl — Wentworth, J. E., J. P. Bailey & R. J. Gornall. 1991. Contributions to a cytological catalogue of the British and Irish flora, 1. Watsonia 18: 415–417.
CCDB · ipcn-api-dl — Queirós, M. 1991. Números cromossómicos para a flora Portuguesa. 104--105. Bol. Soc. Brot., sér. 2 64: 135–142.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.
CCDB · ipcn-api-dl — Van Loon, J. C. & H. C. M. Snelders. 1979. In IOPB chromosome number reports LXV. Taxon 28: 632–634.
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora. (Part 2). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 18: 45-60.
CCDB · book-ipcn73-74 — DAHLGREN, R., TH. KARLSSON, & P. LASSEN. 1971. Studies on the flora I < the Balearic Islands. I. Chromosome numbers in Balearic angiosperms. sot. Notiser 124: 249~269.
CCDB · book-ipcn73-74 — LOEVE, A., & E. KJELLQVIST. 1974. Cytotaxonomy of Spanish plants. IV. Dicotyledons: Caesalpiniaceae- Asteraceae. Lagascalia 4: 153-211.
CCDB · book-atlas-flowering-plants — Fagerlind 1937
CCDB · Cave1956 — Love & Love b
CCDB · CromoCat 2015 — Ancev, M. E. (1975b). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLIX]. Taxon 24(4): 514.
CCDB · CromoCat 2015 — Dahlgren, R., Karlsson, Th. & Lassen, P. (1971). Studies on the Flora of the Balearic Islands, I. Chromosome numbers in Balearic Angiosperms. Bot. Not. 124(1): 249-269.
CCDB · CromoCat 2015 — Fagerlind, F. (1934). Beiträge zur Kenntnis der Zytologie der rubiaceen. Hereditas 19: 223-232.
CCDB · CromoCat 2015 — Fagerlind, F. (1937). Embryologische, zytologische und bestäubungs experimentelle Studien in der Familie Rubiaceae nebst Bemerkungen über einige Polyploiditätsprobleme. Acta Horti Berg. 11: 195-470.
CCDB · CromoCat 2015 — Homeyer, H. (1932). Zur Zytologie der Rubiaceen. (Vorl. Mitt.). Planta 18: 640.
CCDB · CromoCat 2015 — Homeyer, H. (1936). Beiträge zur Kenntnis der Zytologie und Systematik der Rubiaceen. Bot. Jahrb. Syst. 67: 237-263.
CCDB · CromoCat 2015 — Loon van, J. C. & Snelders, H. M. (1979). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXV]. Taxon 28(5/6): 627-637.
CCDB · CromoCat 2015 — Löve, A. & Kjellqvist, E. (1974b). Cytotaxonomy of Spanish plants. IV.-Dicotyledons: Caesalpinaceae-Asteraceae. Lagascalia 4(2): 153-211.
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1956b). Cytotaxonomical conspectus of the Icelandic flora. Acta Horti Gothob. 20(4): 65-291.
CCDB · CromoCat 2015 — Lövkvist, B. & Hultgård, U.-M. (1999). Chromosome numbers in south Swedish vascular plants Opera botanica 137: 1-42
CCDB · CromoCat 2015 — Poucques, M. -L., de. (1948). Relations entre caryologie et systématique chez les Rubiales. Bull. Soc. Sci. Nancy 7: 33-39.
CCDB · CromoCat 2015 — Poucques, M. -L., de. (1949a). Recherches caryologiques sur les Rubiales. Rev. Gén. Bot. 56 659:5-27,660:74-96,661:97-1,662:172-188.
CCDB · CromoCat 2015 — Queirós, M. (1986). Notas cariológicas em Rubiaceae Portuguesas. Bol. Soc. Brot. 2(59): 233-243.
CCDB · CromoCat 2015 — Queirós, M. (1987). Notas cariológicas em Rubiaceae portuguesas. Bol. Soc. Brot. 59: 233-243.
CCDB · CromoCat 2015 — Queirós, M. (1991a). Números cromossómicos para a flora portuguesa. 104-115. Bol. Soc. Brot. 64: 135-142.
CCDB · CromoCat 2015 — Reese, G. (1957). Über die Polyploidiespektren in der nordsaharischen Wüstenpflanzen. Flora 144: 598-634.
CCDB · CromoCat 2015 — Strid, A. & R. Franzén. (1981). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXIII]. Taxon 30(4): 829-842.
+3 more references
n 115×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · Cave1957 +1
CCDB · ipcn-api-dl — Galland, N. 1988. Recherche sur l'origine de la flore orophile du Maroc étude caryologique et cytogéographique. Trav. Inst. Sci. Univ. Mohammed V, Sér. Bot. 35: 1–168.
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · Cave1957 — Reese
CCDB · CromoCat 2015 — Galland, N. (1988). Recherche sur l'origine de la flore orophile du Maroc: Étude caryologique et cytogéographique. Trav. Inst. Scientifique Rabat, sér. Bot. 35: 1-168.
CCDB · CromoCat 2015 — Taylor, R. L. & G. A. Mulligan. (1968). Flora of the Queen Charlotte Island. Part 2. Cytologiacl aspects of the Vascular Plants. Queen's Printer Ottawa
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · family-scale
PloiDB · family-scale — chromEvol; reliability=0.988 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness93.8% BUSCO
07Deep time~21.6 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin21.6 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type174 442 records
Wild obs. + sensor166 567
Museum / vouchered7 309
Cultivated / captive18
Other548
Origin
Native14 416
Introduced1 538
Range
Area of Occupancy AOO273 996 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy47% within 1 km
≤100 m 43 119≤1 km 21 508≤10 km 71 354>10 km 2 605
138 586 georeferenced · 27 981 without coordinates
Open the mapobservation + sensor166 567
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy55% within 1 km
≤100 m 453≤1 km 1 525≤10 km 1 473>10 km 118
3 569 georeferenced · 3 740 without coordinates
Open the institutions mapphysical evidence7 309
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 1>10 km 11
12 georeferenced · 6 without coordinates
Open the mapnot free-living18
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions199 of 319 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 682 |
| Berlin, DE | 556 |
| BIO-UNIPIlocation not on record | 545 |
| LDlocation not on record | 448 |
| Adelaide, AU | 200 |
| BRNUlocation not on record | 189 |
| BFLlocation not on record | 162 |
| MeiseBGlocation not on record | 144 |
| Uppsala, SE | 134 |
| CICYTEXlocation not on record | 133 |
| Museo Entomologico de Leonlocation not on record | 102 |
| València, ES | 101 |
| Oskarshamn, SE | 90 |
| Moscow State Universitylocation not on record | 87 |
| Mount Annan, AU | 75 |
| Fort Worth, US | 68 |
| SLU Artdatabankenlocation not on record | 67 |
| Adam Mickiewicz University in Poznańlocation not on record | 66 |
| MAlocation not on record | 64 |
| Entomological Society of Latvialocation not on record | 62 |
| BClocation not on record | 59 |
| Canberra, AU | 59 |
| Córdoba, ES | 58 |
| ISAlocation not on record | 56 |
| Provincia di Livornolocation not on record | 55 |
| Auckland, NZ | 55 |
| Corvallis, US | 52 |
| BDBClocation not on record | 52 |
| Hobart, AU | 51 |
| Olocation not on record | 47 |
| Wuzhou, CN | 47 |
| Salzburg, AT | 47 |
| Saint Louis, US | 46 |
| College of the Atlantic, Museumlocation not on record | 46 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 44 |
| Wlocation not on record | 42 |
| Görlitz, DE | 41 |
| Badajoz, ES | 40 |
| WTUlocation not on record | 37 |
| South Kensington, GB | 37 |
| Vitoria, ES | 35 |
| Wellington, NZ | 34 |
| Austin, US | 34 |
| Bronx, US | 33 |
| Pamplona, ES | 30 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 30 |
| Philadelphia, US | 30 |
| Madrid, ES | 29 |
| Canadian Department of Agriculturelocation not on record | 28 |
| UIBlocation not on record | 28 |
| Kensington, AU | 27 |
| Bern, CH | 26 |
| Brussel, BE | 26 |
| Frankfurt am Main | 26 |
| Salamanca, ES | 25 |
| Riverside, US | 25 |
| Barcelona, ES | 25 |
| Chongqing Museumlocation not on record | 25 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 25 |
| Davis, US | 24 |
| Mlocation not on record | 23 |
| Phyletisches Museum Jenalocation not on record | 23 |
| Bergen, NO | 22 |
| Granada, ES | 21 |
| Williamsburg, US | 21 |
| Alicante, ES | 21 |
| Arcata, US | 20 |
| BAYLUlocation not on record | 19 |
| GJOlocation not on record | 19 |
| Christchurch, NZ | 19 |
| Tuscaloosa, US | 19 |
| Odawara, JP | 18 |
| Jaén, ES | 18 |
| Turku, FI | 17 |
| Chapel Hill, US | 15 |
| Oulu, FI | 15 |
| Norfolk, US | 15 |
| Claremont, US | 15 |
| Fayetteville, US | 15 |
| Pullman, US | 15 |
| Bando, JP | 14 |
| Kawasaki Shi Tama Ku, JP | 14 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 14 |
| Dresden, DE | 13 |
| Zürich, CH | 13 |
| DBF-NHMDlocation not on record | 13 |
| Natural History Museum Rotterdamlocation not on record | 12 |
| San Luis Obispo, US | 12 |
| Santa Barbara, US | 12 |
| Zürich, CH | 12 |
| Rotorua, NZ | 12 |
| Frauenfeld, CH | 11 |
| GAlocation not on record | 11 |
| Sevilla, ES | 11 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 10 |
| Chicago, US | 10 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 10 |
| EEZA-CSIClocation not on record | 10 |
| US | 10 |
| Brisbane, AU | 9 |
| Tsukuba, JP | 9 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 9 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 9 |
| College Park, US | 9 |
| EL PASO, US | 9 |
| KMNlocation not on record | 9 |
| Angwin, US | 9 |
| Pamplona, ES | 8 |
| Victoria, CA | 8 |
| Long Beach, US | 8 |
| Portland, US | 7 |
| LfUlocation not on record | 7 |
| Xiamen, CN | 7 |
| Tilburg, NL | 7 |
| TUR-Alocation not on record | 7 |
| UChlocation not on record | 7 |
| San Diego, US | 7 |
| Armidale, AU | 7 |
| Kew, GB | 7 |
| University of Stellenboschlocation not on record | 7 |
| ASUlocation not on record | 6 |
| Bangkok, TH | 6 |
| J.F.Oberlin Universitylocation not on record | 6 |
| Trondheim, NO | 6 |
| Bourges, FR | 6 |
| Vancouver, CA | 6 |
| Porrentruy, CH | 6 |
| Nijmegen, NL | 6 |
| Bloomington, US | 6 |
| TROMlocation not on record | 6 |
| CJBGlocation not on record | 6 |
| University of Tennessee at Chattanoogalocation not on record | 6 |
| Emporia, US | 6 |
| Toyama, JP | 6 |
| BISHlocation not on record | 5 |
| Göteborg, SE | 5 |
| Kochi, JP | 5 |
| Glarus, CH | 5 |
| UGentlocation not on record | 5 |
| NMBU:MINAlocation not on record | 5 |
| CASlocation not on record | 5 |
| Jena Microbial Resource Collectionlocation not on record | 5 |
| Columbia, US | 5 |
| Dover, US | 5 |
| Uniwersytet Śląski w Katowicachlocation not on record | 5 |
| Parthenon Tama History Museumlocation not on record | 5 |
| BSBIlocation not on record | 5 |
| JBSlocation not on record | 5 |
| Stephenville, US | 5 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 5 |
| PrivatHerblocation not on record | 5 |
| University of Southern Mississippilocation not on record | 5 |
| Valparaiso, CL | 5 |
| Sanda, JP | 5 |
| Fulda, DE | 5 |
| Osaka, JP | 4 |
| National Museum Waleslocation not on record | 4 |
| SZUlocation not on record | 4 |
| Batemans Bay, AU | 4 |
| Pretoria, ZA | 4 |
| QVMAGlocation not on record | 4 |
| OLAlocation not on record | 4 |
| San Angelo, US | 4 |
| Ashland, US | 4 |
| Flagstaff, US | 4 |
| Moscow, US | 4 |
| Mexico City, MX | 4 |
| Helsinki, FI | 4 |
| Texas Lutheran Universitylocation not on record | 4 |
| Conway, US | 3 |
| Denton, US | 3 |
| Durham, US | 3 |
| Millersville, US | 3 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 3 |
| TAIElocation not on record | 3 |
| Hunan Geological Museumlocation not on record | 3 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 3 |
| Portland, US | 3 |
| Provo, US | 3 |
| PRClocation not on record | 3 |
| DOI/NPS, San Juan Island National Historical Parklocation not on record | 3 |
| Uniwersytet Opolskilocation not on record | 3 |
| Museo Achille Folettolocation not on record | 3 |
| Los Angeles, US | 3 |
| Morgantown, US | 3 |
| Dekalb, US | 3 |
| Namur, BE | 3 |
| La Paz, BO | 3 |
| Palmerston North, NZ | 3 |
| Durango, MX | 3 |
| Montréal, CA | 3 |
| Podgorica, ME | 3 |
| Aarhus, DK | 3 |
| New Brunswick, US | 3 |
| US | 3 |
| Fukushima Universitylocation not on record | 3 |
| National Biodiversity Institute, Costa Ricalocation not on record | 3 |
| Paris, FR | 2 |
| Johnson City, US | 2 |
| LINUlocation not on record | 2 |
| Ann Arbor, US | 2 |
| Irvine, US | 2 |
| Burlington, US | 2 |
| University of Guelph, OAC Herbariumlocation not on record | 2 |
| University of New Hampshirelocation not on record | 2 |
| CJBNlocation not on record | 2 |
| H-AkrKGlocation not on record | 2 |
| Tennessee Technological Universitylocation not on record | 2 |
| Tampa, US | 2 |
| Edmonton, CA | 2 |
| Nagano City, JP | 2 |
| Monastir, TN | 2 |
| Columbus State Universitylocation not on record | 2 |
| Tokushima, JP | 2 |
| JP | 2 |
| Honolulu, US | 2 |
| Santiago, CL | 2 |
| Tartu, EE | 2 |
| Beijing, CN | 2 |
| San Isidro, AR | 2 |
| Coimbra, PT | 2 |
| Chapingo, MX | 2 |
| Québec, CA | 2 |
| Pittsburg, US | 2 |
| CIBIOlocation not on record | 2 |
| Uniwersytet Warszawskilocation not on record | 2 |
| Philadelphia, US | 2 |
| Stockholm, SE | 2 |
| New Haven, US | 2 |
| Sion, CH | 2 |
| Research Center in Biodiversity and Genetic Resourceslocation not on record | 2 |
| Phoenix, US | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| Tacoma, US | 2 |
| Clemson, US | 2 |
| UFRRJlocation not on record | 2 |
| ULBF-AGRlocation not on record | 2 |
| Durham, US | 1 |
| Garðabær, IS | 1 |
| Santiago de Compostela, ES | 1 |
| Tomioka, JP | 1 |
| Wollongong, AU | 1 |
| John T. Waterhouse Herbariumlocation not on record | 1 |
| Smithfield, AU | 1 |
| Palmerston, AU | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Bureau of Land Management, Medford District Officelocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| Fort Bragg, US | 1 |
| Seropédica, BR | 1 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| Bend, US | 1 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 1 |
| Little Rock, US | 1 |
| Tall Timbers Research Stationlocation not on record | 1 |
| Chadron, US | 1 |
| Valdosta State Universitylocation not on record | 1 |
| Fairfax, US | 1 |
| Banyoles, ES | 1 |
| Austin, US | 1 |
| Santa Cruz, US | 1 |
| Jyväskylä, FI | 1 |
| Due West, US | 1 |
| FLADlocation not on record | 1 |
| Karlsruhe, DE | 1 |
| Cochabamba, BO | 1 |
| Mexico City, MX | 1 |
| San Jose, US | 1 |
| WAGlocation not on record | 1 |
| Davenport, US | 1 |
| Turlock, US | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Conway, US | 1 |
| Universidad de Nariño (UdeNar)location not on record | 1 |
| Minia, EG | 1 |
| Henderson, US | 1 |
| Quito, EC | 1 |
| HJAEFlocation not on record | 1 |
| KURAlocation not on record | 1 |
| Universidad Nacional de Colombia (UNAL)location not on record | 1 |
| Kingston, US | 1 |
| Saint John, CA | 1 |
| Elikins, US | 1 |
| Citadel Hill, GB | 1 |
| Macomb, US | 1 |
| Mount Berry, US | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Mississippi State, US | 1 |
| Taipei, TW | 1 |
| GB | 1 |
| University of Genevalocation not on record | 1 |
| Madrid, ES | 1 |
| Cambridge, US | 1 |
| Shinshu Universitylocation not on record | 1 |
| University of North Carolina at Pembrokelocation not on record | 1 |
| Universidad de Caldas (UCaldas)location not on record | 1 |
| Cape Town, ZA | 1 |
| DASSHlocation not on record | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| Northridge, US | 1 |
| Sagamihara, JP | 1 |
| Porvoo, FI | 1 |
| Cuenca, EC | 1 |
| Riobamba, EC | 1 |
| Sendai, JP | 1 |
| Universidad de Antioquia (UdeA)location not on record | 1 |
| Rishon Le Zion, IL | 1 |
| Madison, US | 1 |
| Henry Brockhouse Collectionlocation not on record | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 1 |
| Winterthur, CH | 1 |
| La Trobe Universitylocation not on record | 1 |
| Knoxville, US | 1 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 1 |
| Edinburgh, GB | 1 |
| Boise, US | 1 |
319 institutions · 6 762 of 7 309 vouchered records shown · 539 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA24 detections
Where the DNA of Sherardia arvensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found24
Studies independent surveys2
Countries7
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 24 detections have coordinates
Open the map7 countries0
meadow
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.8 °C 12.2–16.9
Seasonal swing summer↔winter15.2 °C
Max temp (day)17.6 °C 15.4–20.5
Min temp (night)10.4 °C 8.00–13.4
Precipitation72.2 mm/mo 62.4–97.0
Air humidity59.8 % 56.0–63.9
Moisture balance-36.2 mm/mo -69.0–49.0
Vapour deficit635 Pa 564–804
Wind speed2.90 m/s 2.40–4.40
Cloud cover40.9 % 36.0–49.6
CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.