Sheilanthera pubens

I.Williams · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Rutaceae/Sheilanthera

At a glance

Occurrence records10

Data sources7

Biological traits14

DNA specimens2

eDNA detections1

Sources7 archives

Databases and archives Sheilanthera pubens's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility10 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF10 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Sheilanthera is a monotypic genus of flowering plants belonging to the family Rutaceae. The only known species is Sheilanthera pubens. It is native to the Cape Provinces in the South African Republic. The genus name of Sheilanthera is in honour of Sheila Williams, wife and colleague of Ion James Muirhead Williams (1912–2001), a South African botanist and author of the genus. The Latin specific epithet of pubens means fuzzy or pubescent, derived from pubesco. It was first described and published in J. S. African Bot. Vol.47 on page 761 in 1981.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.4 m

Plant height min0.3 m

Life cycle & reproduction2

Life formsubshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 600 m

Elevation min1 300 m

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sheilanthera pubens has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes4

GenBank sequences3

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMW824649.1 ↗598 bp

ACGT

CCAGCAGAACGACCCGCGAACTCGTGAATACACAAAGAGGGCATGCTCTGCGAGCGTCGCTCTCCCCTCGTCGCGGGTGTGGGACTCGTC …

Sheilanthera pubens voucher Esterhuysen 27899 (BOL) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type10 records

Museum / vouchered10

Range

Area of Occupancy AOO16 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 9 without coordinates

Open the institutions mapphysical evidence10

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cape Town, ZA	6
Pretoria, ZA	2
University of Cape Town, Bolus Herbariumlocation not on record	1
Auckland, NZ	1

4 institutions · 10 of 10 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Sheilanthera pubens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.7 °C 16.7–16.7

Seasonal swing summer↔winter13.2 °C

Max temp (day)22.9 °C

Min temp (night)9.80 °C

Precipitation23.5 mm/mo

Air humidity52.0 %

Moisture balance-112 mm/mo

Vapour deficit915 Pa

Wind speed2.40 m/s

Cloud cover12.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)