Shargacucullia prenanthis

Boisduval, 1840 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Shargacucullia

At a glance

Occurrence records532

Data sources8

Biological traits2

DNA specimens10

eDNA detections13

Sources8 archives

Databases and archives Shargacucullia prenanthis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility532 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF532 records

Environmental DNA1 datasets · 4 countries13 detections

DNA & barcodingBOLD10 specimens

Genome at a glanceGoaT · NCBI≈404 Mbp

01Narrative

The false water betony (Shargacucullia prenanthis) is a moth of the family Noctuidae. It is found from south-eastern France, through the Alps and bordering mountains east to Romania and Bulgaria. It is also found in Anatolia and Lebanon.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Shargacucullia prenanthis has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

eDNA detections13

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

58Amostly conserved

106Tvariable

265Cvariable

622Gvariable

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTACTAATTCGAGCAGAATTAGGTACCCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.26%

Haplotypes4

BIN1

Most divergent pair0.61%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Cucullia scrophulariphagasame family6.1%Shargacucullia thapsiphagasame genus6.2%Calocucullia celsiaesame family6.2%Cucullia thapsiphagasame family6.2%Phidrimana amurensissame family6.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Shargacucullia prenanthis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈403 861 616 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Shargacucullia prenanthis0.40 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.8% BUSCO

08Occurrence & distribution

Record type532 records

Wild obs. + sensor195

Museum / vouchered307

Other30

Origin

Native217

Range

Area of Occupancy AOO628 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy12% within 1 km

≤100 m 9≤1 km 14≤10 km 165

188 georeferenced · 7 without coordinates

Open the mapobservation + sensor195

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 5≤1 km 74≤10 km 204>10 km 15

298 georeferenced · 9 without coordinates

Open the institutions mapphysical evidence307

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zürich, CH	51
Archäologie und Museum Baselland - Museum.BLlocation not on record	39
Salzburg, AT	38
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	37
Bern, CH	24
Glarus, CH	10
Dhaka, BD	8
Tiroler Landesmuseum Ferdinandeumlocation not on record	8
Naturama Aargaulocation not on record	5
Naturmuseum St. Gallenlocation not on record	4
Winterthur, CH	4
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	4
SFRAlocation not on record	4
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	3
Universität Zürich, Naturhistorisches Museumlocation not on record	3
Frauenfeld, CH	2
ZSMlocation not on record	2
Philadelphia, US	2
Provincia di Livornolocation not on record	2

19 institutions · 250 of 307 vouchered records shown · 57 without an institution code

09Environmental DNA13 detections

Where the DNA of Shargacucullia prenanthis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.2 °C 7.40–17.2

Seasonal swing summer↔winter19.3 °C

Max temp (day)16.0 °C 11.5–21.5

Min temp (night)5.80 °C 2.10–11.4

Precipitation128 mm/mo 64.8–194

Air humidity59.3 % 56.8–63.4

Moisture balance9.50 mm/mo -55.6–75.3

Vapour deficit584 Pa 389–830

Wind speed2.80 m/s 2.10–3.80

Cloud cover37.3 % 34.6–39.9

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)