Setaria parviflora
(Poir.) Kerguélen · speciesAt a glance
Occurrence records22 723
Data sources13
Biological traits58
DNA specimens18
eDNA detections16
Sources13 archives
Databases and archives Setaria parviflora's data was compiled from.
WikipediaWikimedia Foundation7 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility22 723 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics18 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources58 traits
Occurrence & distributionGBIF22 723 records
Environmental DNA3 datasets · 5 countries16 detections
DNA & barcodingBOLD · NCBI18 specimens
Genome at a glanceCCDB · GoaT2.3 Gbp
01Narrative
Setaria parviflora is a species of grass known by the common names marsh bristlegrass, knotroot bristle-grass, bristly foxtail and yellow bristlegrass. It is native to North America, including Mexico and the United States from California to the East Coast, Central America and the West Indies,Setaria parviflora. Grass Manual Treatment. and South America. This grass is a perennial with small, knotty rhizomes. It produces stems 30 centimeters to well over one meter tall. The leaf blades are up to 25 centimeters long and under a centimeter wide. The leaves are whitish-green.Setaria parviflora. USDA NRCS Plant Fact Sheet. The inflorescence is a compact, spikelike panicle up to 8 or 10 centimeters long. Surrounding each spikelet are up to 12 yellow or purple bristles. The bristles stay on the stalk after the seeds drop away. This grass grows in moist habitat. It can grow in salty habitat such as salt marshes.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRY
Size & morphology21
Inflorescence length max11 cm
Leaf length225 mm
Leaf length max200 mm
Leaf length min80 mm
Leaf size562 mm²
⚠ sources differ — TRY: 562 mm² · AusTraits: 1 425 mm²
Leaf width7.5 mm
⚠ sources differ — AusTraits: 7.5 mm · GIFT: 4 mm
Leaf width max25 mm
Leaf width min1.5 mm
Plant height0.95 m
⚠ sources differ — GIFT: 0.95 m · AusTraits: 0.6 m · TRY: 0.521 m
Plant height generative0.695 m
Plant height max3.5 m
Plant height min0.3 m
Seed length1.2 mm
Seed length max1.2 mm
Seed length min1.2 mm
Seed mass0.4 mg
⚠ sources differ — TRY: 0.4 mg · AusTraits: 0.4 mg · GIFT: 0.631 mg
Seed mass max0.925 mg
Seed mass min0.28 mg
Seed volume1.4 mm³
Seed volume max1.4 mm³
Seed volume min1.4 mm³
Life cycle & reproduction15
Dispersal typewind
Flower length max2 mm
Flowering endJul
Flowering startApr
Flowering timeyynnnnnnnnny
Life formannual or perennial
Life spanperennial
⚠ sources differ — TRY: perennial · AusTraits: perennial · GIFT: annual
Pollination modeabiotic
Pollination syndromeself+wind
⚠ sources differ — AusTraits: self wind · GIFT: wind
Raunkiær life formhemicryptophyte
Reproduction asexualpresent
Reproductive maturity1 years
Resprouting capacityresprouts
Self fertilizationabsent
Sex typeandromonoecious
⚠ sources differ — AusTraits: andromonoecious · GIFT: bisexual
Diet & foraging1
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max4 000 m
Elevation mean1 500 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecaryopsis
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: Herb
Habitat GIFTÁrea Antrópica, Campo de Várzea, Cerrado (lato sensu)
Leaf compoundnesssimple
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry5
Leaf c495 mg/g
Leaf dry-matter content (LDMC)239 mg/g
Leaf n12.52 mg/g
Photosynthetic pathwayC4
Specific leaf area (SLA)25.11 mm²/mg
Other traits2
Inflorescencepanicle
Seeds per fruit>1000
05DNA & barcoding18 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Setaria parviflora has left across the world's sequence archives.
At a glance
DNA specimens18
Marker genes5
GenBank sequences9
eDNA detections16
Countries5
The DNA barcodea real sequence read deposited for this species
ACCGTGAACATGTCATCCATGTCGTGCGGGCTTCTGCCCGTGCAAAGGTCCCCGACCTTCTTTACGAGGGAGAGGGACCGCAAAAGAACC …
Setaria parviflora voucher TAIE041985 Chen7317 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL1★rbcLa★ITS8★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Setaria parviflora carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size2 347 200 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Setaria parviflora2.35 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 36 n = 18
Ploidy4× tetraploid · measured
Chromosome records10–782n range36median36mode38records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3612×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +6
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ipcn-api-dl — Brunken, J. N. 1979. Cytotaxonomy and evolution in Pennisetum section Brevivalvula (Gramineae) in tropical Africa. Bot. J. Linn. Soc. 79: 37–49.
CCDB · ipcn-api-dl — Sahu, N. & A. K. Chatterji. 1983. Chromosome study in ten species of Pennisetum Rich. Proc. Indian Sci. Congr. Assoc. 70(3–VI): 91.
CCDB · ipcn-api-dl — Norrmann, G. A., C. L. Quarín & T. J. Killeen. 1994. Chromosome numbers in Bolivian grasses (Gramineae). Ann. Missouri Bot. Gard. 81(4): 768–774.
CCDB · book-ipcn67-71 — GOULD, F.W., & T.R. SODERSTROM. 1970. Chromosome numbers of some Mexican and Colombian grasses. Canad. J. Bot. 48: 1633-1639.
CCDB · book-ipcn67-71 — POHL, R.W., & G. DAVIDSE. 1971. Chromosome numbers of Costa Rican grasses. Brittonia 23: 293-324.
CCDB · book-ipcn73-74 — KAMMACHER, P., G. ANOMA, E. ADJANOHOUN & L. AKE ASS!. 1973. Nombres chromosomiques de Graminees de Cote-d'Ivoire. Candollea 28: 191-217.
CCDB · book-fedorov — Krishnaswamy et al. 1954
CCDB · book-atlas-flowering-plants — Krishnaswamy et al.1954
CCDB · kew — Le Thierry d’Ennequin M, Panaud O, Brown S, Šiljak-Yakovlev S, Sarr A. 1998. First evaluation of nuclear DNA content in Setaria genus by flow cytometry. Journal of Heredity 89: 556-559.
CCDB · Cave1962 — Platzer 1962
CCDB · iapt — IAPT/IOPB Chromosome Data 34
2n 7211×CCDB · iber-fl · CCDB · fl-europaea · CCDB · ipcn-api-dl +6
CCDB · iber-fl — Contribucin al conocimiento cariolgico de las Poaceae en Extremadura (Espaa). III. Devesa, J. A. & al.Bol. Soc. Brot. ser. 264: 35-74(1991).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. I. Gramineae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 243: 20-140(1969).
CCDB · fl-europaea — Fernandes & Queiros
CCDB · ipcn-api-dl — Borgen, L. 1980. Chromosome numbers of Macaronesian flowering plants III. Bot. Macaronés. IV, Cien. 7: 67–76.
CCDB · ipcn-api-dl — Devesa, J. A., T. RUIZ, M. C. Viera, R. Tormo, F. Vázquez, J. P. Carrasco, A. Ortega & J. Pastor. 1991. Contribución al conocimiento cariológico de las Poaceae en Extremadura (España)---III. Bol. Soc. Brot., sér. 2 64: 35–74.
CCDB · book-ipcn66 — Gould 1966
CCDB · book-ipcn67-71 — FERNANDES, A . & M. QUEIROS. 1969. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. I. Gramineae. Bol. Soc. Brat. 43(ser.2l: 3-140.
CCDB · book-indian_vol2 — Davidse, G. & Pohl, R. W. 1972a
CCDB · eflora
CCDB · book-atlas-flowering-plants — Brown 1948
CCDB · Cave1962 — Platzer 1962
2n 107×CCDB · ipcn-api-dl · CCDB · book-indian_vol2 · CCDB · book-fedorov +1
CCDB · ipcn-api-dl — Rao, Y. S., S. A. Rao & M. H. Mengesha. 1993. Pachytene analysis in the genus Pennisetum (L.) Rich. Cytologia 58: 155–160.
CCDB · book-indian_vol2 — Narayan, K.N. 1954 ; Rao, J.T. & Babu, C.N. 1955 ; Swaminathau, M.S. & Nath, J. 1956b
CCDB · book-indian_vol2 — Jauhar, P .P. et al. 1971 ; Rangasamy, S.R.S. 1972
CCDB · book-fedorov — Narayan 1954
CCDB · book-fedorov — Rao J. T., Babu 1955
CCDB · book-fedorov — Swaminathan, Nath 1956b
CCDB · kew — Martel E, de Nay D, Šiljak-Yakovlev S, Brown S, Sarr A. 1997. Genome size variation and basic chromosome number in pearl millet and fourteen related Pennisetum species. Journal of Heredity 88: 139-143.
2n 545×CCDB · ipcn-api-dl · CCDB · book-indian_vol2 · CCDB · eflora +2
CCDB · ipcn-api-dl — Parihar, S. K. & S. N. Tripathi. 1989. Karyotypes of Pennisetum species. J. Indian Bot. Soc. 68: 295–299.
CCDB · book-indian_vol2 — Avdulov, .N.P. (Fedorov) ; Bhatta- charya, B. 1974
CCDB · eflora
CCDB · book-fedorov — ABp;yJIOB 1928
CCDB · book-atlas-flowering-plants — Fo
2n 533×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-indian_vol2
CCDB · ipcn-api-dl — Pohl, R. W. & G. Davidse. 1971. Chromosome numbers of Costa Rican grasses. Brittonia 23(3): 293–324.
CCDB · book-ipcn67-71 — POHL, R.W., & G. DAVIDSE. 1971. Chromosome numbers of Costa Rican grasses. Brittonia 23: 293-324.
CCDB · book-indian_vol2 — Pohl, R.W. & Davidse, G. 1971
2n 221×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Sacchet, A. M. d. O. F., G. G. Born & I. Boldrini. 1980. Citogenética e evolução de gramíneas naturais do RS---g@6enero Setaria. Ci. & Cult. (Sao Paulo) 32: 723.
2n 271×CCDB · book-ipcn75-78
CCDB · book-ipcn75-78 — NA
2n 341×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Nagabhushana Rao Sindhe, A. 1980. In Chromosome number reports LXVIII. Taxon 29: 545.
2n 451×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Norrmann, G. A., C. L. Quarín & T. J. Killeen. 1994. Chromosome numbers in Bolivian grasses (Gramineae). Ann. Missouri Bot. Gard. 81(4): 768–774.
2n 781×CCDB · book-ipcn65
CCDB · book-ipcn65 — Gould 1965
n 367×CCDB · ipcn-api-dl · CCDB · book-ipcn72 · CCDB · book-ipcn67-71 +1
CCDB · ipcn-api-dl — Oliveira Freitas-Sacchet, A. M., I. I. Boldrini & G. G. B. 1984. Cytogenetics and evolution of the native grasses of Rio Grande do Sul, Brazil, Setaria Beauv. (Gramineae). Revista Brasil. Genét. 7: 535–548.
CCDB · ipcn-api-dl — Freitas-Sacchet, A. M. d. O., I. I. Boldrini & G. G. Born. 1984. Cytogenetics and evolution of the native grasses of Rio Grande do Sul, Brazil---Setaria Beauv. (Gramineae). Revista Brasil. Genét. 7(3): 535–548.
CCDB · ipcn-api-dl — De Oliveira Freitas Sacchet, A. M. 1980. In Chromosome number reports LXIX. Taxon 29: 703–704.
CCDB · book-ipcn72 — DAVIDSE, G., & R.W. POHL. 1972. Chromosome numbers and notes on some Central American grasses. Canad. J. Bot. 50: 273-283.
CCDB · book-ipcn72 — HSU, C-C. 1972. Preliminary chromosome studies on the vascular plants of Taiwan (V). Cytotaxonomy on some monocotyledons. Taiwania 17: 48-65.
CCDB · book-ipcn67-71 — CRANG, R.E., & H.L. DEAN. 1971. An intergeneric hybrid in the Sileneae (Caryophyllaceael. Bull. Torrey Bot. Club. 98: 214-217.
CCDB · book-ipcn75-78 — Boldrini 1978
n 185×CCDB · ipcn-api-dl · CCDB · book-ipcn72 · CCDB · book-ipcn75-78
CCDB · ipcn-api-dl — Oliveira Freitas-Sacchet, A. M., I. I. Boldrini & G. G. B. 1984. Cytogenetics and evolution of the native grasses of Rio Grande do Sul, Brazil, Setaria Beauv. (Gramineae). Revista Brasil. Genét. 7: 535–548.
CCDB · book-ipcn72 — RANGASAMY, S.R.R. 1972. Cytological studies on diploid and polyploid taxa of the genus Pennisetum Rich. Genetica 43: 257-273.
CCDB · book-ipcn75-78 — NA
CCDB · book-ipcn75-78 — Gupta & Singh 1977
n 272×CCDB · book-ipcn75-78
CCDB · book-ipcn75-78 — Olorode 1975
CCDB · book-ipcn75-78 — Dujardiii 1978
n 51×CCDB · book-ipcn72
CCDB · book-ipcn72 — RANGASAMY, S.R.R. 1972. Cytological studies on diploid and polyploid taxa of the genus Pennisetum Rich. Genetica 43: 257-273.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
07Deep time~1.39 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin1.39 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type22 723 records
Wild obs. + sensor13 700
Museum / vouchered7 740
Cultivated / captive3
Other1 280
Origin
Native620
Introduced7 966
Range
Area of Occupancy AOO49 888 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy90% within 1 km
≤100 m 8 691≤1 km 1 825≤10 km 963>10 km 267
11 746 georeferenced · 1 954 without coordinates
Open the mapobservation + sensor13 700
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy65% within 1 km
≤100 m 1 324≤1 km 548≤10 km 838>10 km 178
2 888 georeferenced · 4 852 without coordinates
Open the institutions mapphysical evidence7 740
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 3 records without
Open the mapnot free-living3
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions190 of 380 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Saint Louis, US | 632 |
| University of Stellenboschlocation not on record | 413 |
| Mexico City, MX | 395 |
| Bronx, US | 366 |
| Durango, MX | 203 |
| Wuzhou, CN | 162 |
| Tampa, US | 152 |
| Museo Entomologico de Leonlocation not on record | 146 |
| Canberra, AU | 141 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 120 |
| Kew, GB | 116 |
| Austin, US | 111 |
| Mount Annan, AU | 104 |
| Fort Worth, US | 99 |
| Université de Bordeauxlocation not on record | 92 |
| Guasave, MX | 89 |
| Jena Microbial Resource Collectionlocation not on record | 84 |
| Brisbane, AU | 83 |
| Brasília, BR | 81 |
| National Biodiversity Institute, Costa Ricalocation not on record | 79 |
| Pittsburg, US | 78 |
| Auckland, NZ | 78 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 77 |
| Claremont, US | 73 |
| UFMSlocation not on record | 70 |
| Riverside, US | 67 |
| Xiamen, CN | 66 |
| Davis, US | 65 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 65 |
| San Diego, US | 62 |
| Córdoba, AR | 57 |
| Williamsburg, US | 52 |
| Universidad Nacional de Colombia (UNAL)location not on record | 51 |
| US | 49 |
| Comisión Técnico Consultiva de Coeficientes de Agostaderolocation not on record | 46 |
| Cenargenlocation not on record | 45 |
| Bloomington, US | 44 |
| Jackson, US | 44 |
| Adelaide, AU | 42 |
| Paleontological Collectionlocation not on record | 42 |
| Ann Arbor, US | 41 |
| CJBGlocation not on record | 38 |
| Brasília, BR | 38 |
| Puerto Ayora, EC | 38 |
| BIO-UNIPIlocation not on record | 38 |
| Juriquilla, MX | 38 |
| Antiguo Cuscatlán, SV | 36 |
| UnBlocation not on record | 34 |
| BDBClocation not on record | 34 |
| Armidale, AU | 32 |
| Emporia, US | 32 |
| Mérida, MX | 32 |
| Tapachula, MX | 32 |
| Canadian Department of Agriculturelocation not on record | 30 |
| Chongqing Museumlocation not on record | 30 |
| Santa Barbara, US | 28 |
| Aarhus, DK | 28 |
| UFMGlocation not on record | 28 |
| California Academy of Scienceslocation not on record | 27 |
| Laboratorio de Ictiologialocation not on record | 26 |
| Masindi, UG | 26 |
| Salvador, BR | 26 |
| Torreón, MX | 25 |
| Texas Lutheran Universitylocation not on record | 24 |
| Chaguaramas, TT | 24 |
| Tuscaloosa, US | 24 |
| Kensington, AU | 24 |
| Istituto Agrario Castelnuovolocation not on record | 24 |
| Valdosta State Universitylocation not on record | 23 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 23 |
| College Park, US | 23 |
| Universidad de Caldas (UCaldas)location not on record | 23 |
| Logan, US | 22 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 22 |
| St. Augustine, TT | 22 |
| UNIVASFlocation not on record | 21 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 21 |
| Universidade Federal de Sergipe (UFS)location not on record | 20 |
| Christchurch, NZ | 20 |
| Little Rock, US | 20 |
| Berlin, DE | 19 |
| Chapel Hill, US | 19 |
| CASlocation not on record | 19 |
| Universidade Federale do Rio Grande do Sullocation not on record | 19 |
| UFERSAlocation not on record | 19 |
| Columbia, US | 19 |
| BISHlocation not on record | 19 |
| GAlocation not on record | 19 |
| Lubbock, US | 19 |
| MeiseBGlocation not on record | 18 |
| JBRJlocation not on record | 18 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 18 |
| BClocation not on record | 18 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 18 |
| UFBAlocation not on record | 18 |
| Feira de Santana, BR | 17 |
| Loja, EC | 16 |
| Hobart, AU | 16 |
| Santa Cruz de la Sierra, BO | 16 |
| TAIElocation not on record | 15 |
| FUVATESlocation not on record | 15 |
| Zacatecas, MX | 15 |
| Madison, US | 15 |
| John T. Waterhouse Herbariumlocation not on record | 15 |
| San Luis Obispo, US | 14 |
| Bangkok, TH | 14 |
| UFSClocation not on record | 14 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 14 |
| San José, CR | 14 |
| Ivano-Frankivsk, UA | 13 |
| ASUlocation not on record | 13 |
| San Isidro, AR | 13 |
| Honolulu, US | 13 |
| BAYLUlocation not on record | 13 |
| Brussel, BE | 12 |
| Henderson State Universitylocation not on record | 12 |
| València, ES | 12 |
| Rotorua, NZ | 12 |
| Blumenau, BR | 12 |
| UNESClocation not on record | 12 |
| Norfolk, US | 11 |
| Ciudad Autónoma de Buenos Aires, AR | 10 |
| San Francisco de Campeche, MX | 10 |
| Miami, US | 10 |
| University of Southern Mississippilocation not on record | 10 |
| Wollongong, AU | 10 |
| Clemson, US | 10 |
| University of Tennessee at Chattanoogalocation not on record | 10 |
| UEMlocation not on record | 9 |
| Chicago, US | 9 |
| Tall Timbers Research Stationlocation not on record | 9 |
| Universidade Federal de Pelotaslocation not on record | 9 |
| Bogotá, D.C., CO | 9 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 9 |
| Santa Cruz, US | 9 |
| Mexico City, MX | 9 |
| Flagstaff, US | 9 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 8 |
| Los Angeles, US | 8 |
| UTFPR-CPlocation not on record | 8 |
| IPA/SPlocation not on record | 8 |
| Universidade Federal do Maranhãolocation not on record | 8 |
| Millersville, US | 8 |
| Burlington, US | 8 |
| MAlocation not on record | 7 |
| DanBIFlocation not on record | 7 |
| Campo Mourão, BR | 7 |
| Cuiabá, BR | 7 |
| Kawasaki Shi Tama Ku, JP | 7 |
| Dekalb, US | 7 |
| LDlocation not on record | 7 |
| University of North Carolina at Pembrokelocation not on record | 7 |
| Durham, US | 7 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 7 |
| León, NI | 7 |
| MEXUlocation not on record | 7 |
| Guatemala City, GT | 7 |
| PUC-RSlocation not on record | 7 |
| International Salmonella Centre (W.H.O.)location not on record | 7 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 7 |
| Foz do Iguaçu, BR | 6 |
| Altos de Pipe, VE | 6 |
| Departamento de Sistematica e Ecologialocation not on record | 6 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 6 |
| Lord Fairfax Community Collegelocation not on record | 6 |
| CEPLAClocation not on record | 6 |
| Universidade Federal de Goiáslocation not on record | 6 |
| UNESP-ISlocation not on record | 6 |
| UDESC-CAVlocation not on record | 6 |
| Ixtacuixtla de Mariano Matamoros, MX | 6 |
| UFPElocation not on record | 6 |
| HACAMlocation not on record | 6 |
| Ural Federal University "B. N. Yeltsin"location not on record | 6 |
| UFRPElocation not on record | 6 |
| Columbus State Universitylocation not on record | 6 |
| AUAlocation not on record | 5 |
| DOI/NPS, Greenbelt Parklocation not on record | 5 |
| USP-IBlocation not on record | 5 |
| Montecillo, Texcoco, MX | 5 |
| GB | 5 |
| Puebla, MX | 5 |
| Museu Paraense Emílio Goeldilocation not on record | 5 |
| Arcata, US | 5 |
| Philadelphia, US | 5 |
| UFESlocation not on record | 5 |
| US | 5 |
| The University of Arizonalocation not on record | 5 |
| Moscow State Universitylocation not on record | 5 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 5 |
| Corrientes, AR | 5 |
| Ciudad de México, MX | 5 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 5 |
| New Mexico State Universitylocation not on record | 5 |
| EL PASO, US | 4 |
| CPATSAlocation not on record | 4 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 4 |
| Pelotas, BR | 4 |
| IECOSlocation not on record | 4 |
| UNESP-IBILCElocation not on record | 4 |
| Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record | 4 |
| Centro de Investigación Regional Norte Centro, Campo Experimental La Campana, Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuariaslocation not on record | 4 |
| Morgantown, US | 4 |
| Ciudad Juárez, MX | 4 |
| Albuquerque, US | 4 |
| Tuxtla Gutiérrez, MX | 4 |
| Universidad de los Andes (UniAndes)location not on record | 4 |
| Fayetteville, US | 4 |
| Santa Maria, BR | 4 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 4 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 4 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 4 |
| La Trobe Universitylocation not on record | 4 |
| Johnson City, US | 3 |
| Irvine, US | 3 |
| Oskarshamn, SE | 3 |
| Universidad Pedagógica y Tecnológica de Colombia (UPTC)location not on record | 3 |
| Taipei, TW | 3 |
| UNESP, Campus São José Rio Prêtolocation not on record | 3 |
| Universidade Federal de Santa Catarinalocation not on record | 3 |
| Stockholm, SE | 3 |
| Montréal, CA | 3 |
| Sucre, BO | 3 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 3 |
| Criciúma, BR | 3 |
| Universidad Industrial de Santander (UIS)location not on record | 3 |
| Sanda, JP | 3 |
| Batemans Bay, AU | 3 |
| Universiti Sains Malaysialocation not on record | 3 |
| HUT Culture Collectionlocation not on record | 3 |
| UEPAlocation not on record | 3 |
| Philadelphia, US | 3 |
| UTFPR-SLlocation not on record | 3 |
| IAPlocation not on record | 3 |
| Conway, US | 3 |
| Fairfax, US | 3 |
| OTSlocation not on record | 3 |
| San Angelo, US | 3 |
| Giardini Botanici Hanburylocation not on record | 3 |
| Pullman, US | 3 |
| ISAlocation not on record | 3 |
| Wellington, NZ | 2 |
| North Carolina Museum of Natural Scienceslocation not on record | 2 |
| Palmerston, AU | 2 |
| Smithfield, AU | 2 |
| BRNUlocation not on record | 2 |
| Pontifícia Universidade Católica do Paranálocation not on record | 2 |
| Tempe, US | 2 |
| Edinburgh, GB | 2 |
| UNIVILLElocation not on record | 2 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 2 |
| Denver, US | 2 |
| Herbario de la Universidad Tecnológica Indoaméricalocation not on record | 2 |
| UNICAMPlocation not on record | 2 |
| Palmerston North, NZ | 2 |
| Toyota city nature sanctuarylocation not on record | 2 |
| Museo Achille Folettolocation not on record | 2 |
| Provo, US | 2 |
| UFOPlocation not on record | 2 |
| UFPIlocation not on record | 2 |
| Knoxville, US | 2 |
| Cascavel, BR | 2 |
| Entomological Society of Latvialocation not on record | 2 |
| Lincoln, US | 2 |
| New Haven, US | 2 |
| Universidad de El Salvadorlocation not on record | 2 |
| UFSMlocation not on record | 2 |
| Toluca, MX | 2 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 2 |
| Cusco, PE | 2 |
| Pondicherry, IN | 2 |
| Salamanca, ES | 2 |
| Wlocation not on record | 2 |
| New Brunswick, US | 2 |
| La Paz, BO | 2 |
| Managua, NI | 2 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 2 |
| San Luis Potosí, MX | 2 |
| Plocation not on record | 2 |
| Hermosillo, MX | 2 |
| Cochabamba, BO | 2 |
| HAWlocation not on record | 1 |
| Richmond, US | 1 |
| LINUlocation not on record | 1 |
| HUAlocation not on record | 1 |
| Laboratory of Palaeontologylocation not on record | 1 |
| Linares, MX | 1 |
| Nishihara, JP | 1 |
| Elocation not on record | 1 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 1 |
| Tulane Universitylocation not on record | 1 |
| Fundación Miguel Lillolocation not on record | 1 |
| Sagamihara, JP | 1 |
| Santiago de Cali, CO | 1 |
| LGlocation not on record | 1 |
| Natural History Museum Rotterdamlocation not on record | 1 |
| INMAlocation not on record | 1 |
| Station d'Ecologie de Lamtolocation not on record | 1 |
| Universidad Nacional de Asunciónlocation not on record | 1 |
| Río Palenque Science Centerlocation not on record | 1 |
| Quito, EC | 1 |
| CICYTEXlocation not on record | 1 |
| Jaén, ES | 1 |
| Audubon Society -- Silver Bluff Audubon Center and Sanctuarylocation not on record | 1 |
| South African National Biodiversity Institutelocation not on record | 1 |
| Papua New Guinea Forest Research Institutelocation not on record | 1 |
| UEMAlocation not on record | 1 |
| Universidade de São Paulolocation not on record | 1 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Toyama, JP | 1 |
| Cambridge, US | 1 |
| Badajoz, ES | 1 |
| China Agricultural Universitylocation not on record | 1 |
| Columbus State University Herbariumlocation not on record | 1 |
| Ilhéus, BR | 1 |
| Chengdu, CN | 1 |
| Minia, EG | 1 |
| Cibinong Science Center, Herbarium Bogorienselocation not on record | 1 |
| Zürich, CH | 1 |
| Anchorage, US | 1 |
| University of South Carolina Salkehatchielocation not on record | 1 |
| Cenit Transporte y Logística de Hidrocarburos S.A.S. (CENIT)location not on record | 1 |
| West Virginia Wesleyan Collegelocation not on record | 1 |
| Sangmiung Universitylocation not on record | 1 |
| Zürich, CH | 1 |
| La Paz, MX | 1 |
| Buenos Aires, AR | 1 |
| San Jose, US | 1 |
| Montpellier, FR | 1 |
| Vitoria, ES | 1 |
| HEMlocation not on record | 1 |
| UTFPR-DVlocation not on record | 1 |
| Paris, FR | 1 |
| Universidade do Estado de Santa Catarinalocation not on record | 1 |
| XALlocation not on record | 1 |
| Dover, US | 1 |
| Madrid, ES | 1 |
| Uppsala, SE | 1 |
| Museo de Historia Natural de El Salvadorlocation not on record | 1 |
| HUENFlocation not on record | 1 |
| Florida Museum of Natural Historylocation not on record | 1 |
| Santa Teresa, BR | 1 |
| Jataí / Setor Industrial, BR | 1 |
| Sendai, JP | 1 |
| Morelia, MX | 1 |
| BMlocation not on record | 1 |
| Cruz das Almas, BR | 1 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 1 |
| Conway, US | 1 |
| McWane Science Centerlocation not on record | 1 |
| Corvallis, US | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| South Kensington, GB | 1 |
| SLU Artdatabankenlocation not on record | 1 |
| ESALQlocation not on record | 1 |
| Northridge, US | 1 |
| Chicago, US | 1 |
| University of New Hampshirelocation not on record | 1 |
| Denton, US | 1 |
| Philadelphia, US | 1 |
| Weber State Universitylocation not on record | 1 |
| Maringá, BR | 1 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 1 |
| UNESP-FCAlocation not on record | 1 |
| BioFokuslocation not on record | 1 |
| J.F.Oberlin Universitylocation not on record | 1 |
| Görlitz, DE | 1 |
| UNESP-RClocation not on record | 1 |
| Santiago de Compostela, ES | 1 |
| Olocation not on record | 1 |
| Fortaleza, BR | 1 |
| Mexico City, MX | 1 |
| UFABClocation not on record | 1 |
| Llocation not on record | 1 |
| NSW Office of Environment and Heritagelocation not on record | 1 |
| Universidad de Córdoba (UC)location not on record | 1 |
| Granada, ES | 1 |
| UNESP-FCAVlocation not on record | 1 |
| Clarksville, US | 1 |
| Universidad Nacional Agrarialocation not on record | 1 |
380 institutions · 7 434 of 7 740 vouchered records shown · 304 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA16 detections
Where the DNA of Setaria parviflora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found16
Studies independent surveys3
Countries5
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 16 detections have coordinates
Open the map5 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median22.7 °C 15.4–25.6
Seasonal swing summer↔winter17.4 °C
Max temp (day)28.4 °C 20.5–31.0
Min temp (night)18.9 °C 10.4–20.8
Precipitation71.3 mm/mo 41.3–118
Air humidity58.6 % 56.6–59.4
Moisture balance-61.2 mm/mo -124–-0.7
Vapour deficit1,187 Pa 774–1,343
Wind speed2.50 m/s 2.00–3.20
Cloud cover34.0 % 20.4–41.0
CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.