Setaria italica
(L.) P.Beauv. · speciesAt a glance
Occurrence records9 163
Data sources13
Biological traits138
DNA specimens51
eDNA detections415
Sources13 archives
Databases and archives Setaria italica's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility9 163 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI415 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics51 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements6 literature sources138 traits
Chemical compositionLOTUS · NPASS63 compounds
Occurrence & distributionGBIF9 163 records
Environmental DNA3 datasets · 7 countries415 detections
DNA & barcodingBOLD · NCBI51 specimens
Genome at a glanceCCDB · GoaT · NCBI489 Mbp
01Narrative
La sétaire d'Italie également appelée « panis », « millet des oiseaux » ou « petit mil » est une plante de la famille des Poacées (graminées), cultivée comme céréale pour ses graines. Le nom vernaculaire « millet des oiseaux » désigne aussi ses graines, qui servent notamment à l'alimentation des oiseaux domestiques.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDAUSDATRYWCVP
Size & morphology22
Fruit length1.75 mm
Leaf length300 mm
Leaf length max900 mm
Leaf length min270 mm
Leaf mass236 mg
Leaf size4 348 mm²
⚠ sources differ — TRY: 4 348 mm² · AusTraits: 1 988 mm² · LEDA: 5 638 mm² · GIFT: 5 638 mm²
Leaf width25 mm
⚠ sources differ — AusTraits: 25 mm · GIFT: 6 mm
Leaf width max120 mm
Leaf width min30 mm
Plant height0.871 m
⚠ sources differ — GIFT: 0.871 m · AusTraits: 1.5 m · LEDA: 0.785 m · USDA: 1.52 m · TRY: 0.806 m
Plant height generative0.682 m
Plant height max1.5 m
Plant height min0.3 m
Seed length2.62 mm
⚠ sources differ — TRY: 2.62 mm · GIFT: 2 mm
Seed length max2 mm
Seed length min2 mm
Seed mass1.95 mg
⚠ sources differ — TRY: 1.95 mg · AusTraits: 2.3 mg · LEDA: 2.97 mg · GIFT: 2.45 mg
Seed mass max2.7 mg
Seed mass min2.06 mg
Seed volume2.1 mm³
Seed volume max2.1 mm³
Seed volume min2.1 mm³
Life cycle & reproduction34
Bloom periodSummer
Coppice potentialNo
Deciduousnessevergreen
Dispersal typeanimal
Flower colourwhite
Flower conspicuousNo
Flowering endSep
Flowering startJul
Flowering timeyynnnnnnnnny
Fruit seed period beginFall
Fruit seed period endWinter
Growth rate USDARapid
Life formannual
Life spanannual
Lifespan years1 years
Pollination modeabiotic
Pollination syndromewind
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formtherophyte
Reproduction asexualabsent
Resprout abilityNo
Seed number14 034
Seed spread rateModerate
Seedling vigorHigh
Sex typeandromonoecious
Vegetative spread rateNone
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment33
Active growth periodSpring and Summer
Adapted to coarse textured soilsNo
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max2 600 m
Elevation mean0 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerPorous
Foliage porosity winterPorous
Foliage textureFine
Fruit colourbrown
Fruit fleshinessdry
Fruit typecaryopsis
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: Graminoid
Growth form USDABunch
Habitat GIFTÁrea Antrópica
Hedge toleranceNone
Known allelopathNo
Leaf compoundnesssimple
Leaf retentionNo
Leaf shapelinear_elliptical
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min8 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry27
Anaerobic toleranceNone
C:N ratioMedium
Caco3 toleranceNone
Cold stratification requiredNo
Drought toleranceLow
Fertility requirementLow
Fire resistantNo
Fire toleranceNone
Frost free days min110 days
Leaf C:N ratio16.21 g/g
Leaf c407 mg/g
Leaf dry-matter content (LDMC)226 mg/g
⚠ sources differ — TRY: 226 mg/g · LEDA: 206 mg/g
Leaf n16.4 mg/g
Leaf p1.56 mg/g
Moisture useLow
Nitrogen fixation levelNone
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC4
⚠ sources differ — TRY: C4 · AusTraits: c4 · GIFT: C3
Precipitation max60 in
Precipitation min25 in
Protein potentialLow
Salinity toleranceLow
Shade toleranceHigh
Soil pH max6.9 pH
Soil pH min5.3 pH
Specific leaf area (SLA)28.07 mm²/mg
⚠ sources differ — TRY: 28.07 mm²/mg · LEDA: 23.91 mm²/mg · GIFT: 23.91 mm²/mg
Temperature min52 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productYes
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalMedium
Palatable graze animalMedium
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound216 600 per lb
ToxicityNone
Veneer productNo
Other traits5
Diaspore typegenerative dispersule
Fall conspicuousYes
Fruit seed abundanceHigh
Fruit seed conspicuousYes
Fruit seed persistenceYes
03Chemical composition63 compounds
Compounds documented for Setaria italica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cooking
Compound class profile5 classes
Flavones27
Stigmastane steroids5
Naphthoquinones3
Cholestane steroids $ Ergostane steroids3
Aminoacids3
Documented compounds63 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1R)-4-[(1E,3E,5E,7E,9E,11E,13E,15E,17E)-18-[(4R)-4-hydroxy-2,6,6-trimethylcyclohex-2-en-1-yl]-3,7,12,16-tetramethyloctadeca-1,3,5,7,9,11,13,15,17-nonaenyl]-3,5,5-trimethylcyclohex-3-en-1-ol | present | NPASS | |
| (2S)-2-(dimethylazaniumyl)-3-(1-methyl-4-sulfanyl-1H-imidazol-5-yl)propanoate | present | NPASS | |
| (2S)-2-azaniumyl-3-(1-methyl-4-sulfanyl-1H-imidazol-5-yl)propanoate | present | NPASS | |
| (3S,8S,9S,10R,13S,14S,17R)-10,13-dimethyl-17-[(Z,2R)-5-propan-2-ylhept-5-en-2-yl]-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol | present | LOTUS | |
| 1,3-Dilinolein | present | NPASS | |
| 24-Methylenecholesterol | present | LOTUS | |
| 24alpha-Ethyl-5alpha-cholest-7-en-3beta-ol | present | LOTUS | |
| 4-Allyloxycoumarin | present | LOTUS | |
| 4-aminobutanoate | present | NPASS | |
| 5,7-dihydroxy-2-(4-hydroxyphenyl)-8-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-4-one | present | LOTUS |
05DNA & barcoding51 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Setaria italica has left across the world's sequence archives.
At a glance
DNA specimens51
Marker genes11
GenBank sequences10
eDNA detections415
Countries7
The DNA barcodea real sequence read deposited for this species
AAATGGCCCCTTTAAAAAAAACCGAACCGTGAACATGTCATCCATCCTGCACGCGGTTCTACCCGTGCAAGGCCCCCGACCTTCTTTCCG …
Setaria italica voucher MU3 internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK★rbcL1★rbcLa★ITS9★ITS2atpF-atpHpsbK-psbIrpoBrpoC1trnH-psbA
animal barcodeplant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Setaria italica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size489 000 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Setaria italica0.49 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 18 n = 9
Ploidy2× diploid · measured
Chromosome records18–362n range18median18mode55records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1852×GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl · CCDB · nw-europe-fl +11
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4702
CCDB · poland — Frey L., Mizianty M. and Mirek Z. 1981. Chromosome numbers of Polish vascular plants. Fragm. Flor. Geobot. 27, 581-590.
CCDB · ipcn-api-dl — Chikara, J. & P. K. GUPTA. 1979. Karyological studies in the genus Setaria. I. Variability within Setaria italica (L.) Beauv. J. Cytol. Genet. 14: 75–79.
CCDB · ipcn-api-dl — Frey, L., M. Mizianty & Z. Mirek. 1981. Chromosome numbers of Polish vascular plants. Fragm. Florist. Geobot. 27: 581–590.
CCDB · ipcn-api-dl — Li, X. l. & R. y. Chen. 1985. The karyotype analysis of Setaria italica and S. viridis. J. Wuhan Bot. Res. 3(4): 409–412.
CCDB · ipcn-api-dl — Zhou, X., P. y. Sun, Y. l. Chou, B. y. Hou & T. Sun. 1989. A study on the basic karyotype of Setaria italica. Sci. Agric. Sin. 22: 30–34.
CCDB · ipcn-api-dl — Sinha, R. R. P., A. K. Bhardwaj & R. K. Singh. 1990. SOCGI plant chromosome number reports---IX. J. Cytol. Genet. 25: 140–143.
CCDB · ipcn-api-dl — Ko|3zuharov, S. I. & A. V. Petrova. 1991. Chromosome numbers of Bulgarian angiosperms. Fitologija 39: 72–77.
CCDB · ipcn-api-dl — Li, M., Y. c. Song & L. h. Liu. 1996. Studies on G-banding karyotypes in millet. J. Henan Vocational-Techn. Teaching Coll. 24(1): 1–7.
CCDB · ipcn-api-dl — Wu, Q. m. & J. l. Bai. 2000. Cytological and isoenzymic studies on Setaria italica, S. verticillata (2@x) and S. verticiformis (4@x). Acta Bot. Boreal.-Occid. Sin. 20(6): 954–959.
CCDB · ipcn-api-dl — Ghukasyan. 2004. Extent of karyological study of Armenian grasses (Poaceae). Fl. Rastitel'n. Rastitel'n. Resursy Armenii 15: 85–89.
CCDB · ipcn-api-dl — Benabdelmouna, A., Y. Shi, M. Abirached-Darmency & H. Darmency. 2001. Genomic in situ hybridization (GISH) discriminates between the A and the B genomes in diploid and tetraploid Setaria species. Genome 44: 685–690.
CCDB · ipcn-api-dl — Benabdelmouna, A. & H. Darmency. 2003. Copia-like retrotransposons in the genus Setaria: Sequence heterogeneity, species distribution and chromosomal organization. Pl. Syst. Evol. 237(3–4): 127–136.
CCDB · ipcn-api-dl — Kandelaki, G. V., A. D. Gorgidze & I. I. Maisaia. 1983. Cytological investigation of some representatives of the genus Setaria P.B. of Georgian Flora. Dokl. Akad. Sci. Gruzinsk. SSR. (Tbilissi). 111(6): 113–115.
CCDB · book-ipcn66 — Singh & Godward 1960
CCDB · book-indian_vol2 — Avdulov, N.P. (Fedorov); Morinaga, T. et al. 1929 ; Nakajima, G. 1930 ; Krishnaswamy, N. & Ayyaogar, R. 1935b ; Kishimoto, E. 1938 ; Parodi, L.R. 1946 ; Krishnaswamy, N. 1951 ; Sharma, A.K. & De, D.N. 1956b ; Chandola, R.P. 1959 ; Singh, D.N. & Goclward, M.B.E. 1960 ; Bowden, W.M. & Senn, H.A. 1962; Pohl, R.W. 1962 ; Willwe!::er-Kishimoto, E. 1962 ; Mehra, P.N. ei a/. 1968; Gupta, P.K. & Yashvir 1971 ; Khosla, P.K. & Sharma, M .L. 1973 ; Bhattacharya, B. 1974 ; Christopher, J. & Abraham, A. 1976; Sinha, R.V. & Gupta, P.K.1977
CCDB · eflora
CCDB · book-atlas-flowering-plants — Avdulov 1928
CCDB · kew — Bennett MD, Hanson L. (pers. comm. 1997).
CCDB · Cave1956 — Sharma & De
CCDB · Cave1959 — Chandola 1959
CCDB · Cave1962 — Bowden & Senn 1962
CCDB · Cave1962 — Willweber-Kish. 1962
CCDB · CromoCat 2015 — Bowden, W. M. & Senn, H. A. (1962). Chromosome numbers in 28 grass genera from South America. Canad. J. Bot. 40: 1115-1124.
CCDB · CromoCat 2015 — Frey, L., Mizianty, M. & Mirek, Z. (1981). Chromosome numbers of polish vascular plants. Fragm. Florist. Geobot. 27: 581-590.
CCDB · CromoCat 2015 — Kozuharov, S. & Petrova, A. (1991). Chromosome numbers of Bulgarian Angiosperms. Fitologija 39: 72-77.
CCDB · CromoCat 2015 — Chandola, R. P. (1959). Cytogenetics of millets (1). Cytologia 24: 115-137.
CCDB · CromoCat 2015 — Hsia, C. A. (1949). Interspecific crosses in Setaria. III. Chromosomal variation in S. italofaberii. Bot. Bull. Acad. Sin. 3: 1-11.
CCDB · CromoCat 2015 — Krishnaswamy, N. & Ayyangar, J. N. R. (1935). Chromosome numbers in some Setaria species. Curr. Sci. 3: 559-560.
CCDB · CromoCat 2015 — Krishnaswamy, N. (1951). Origin and distribution of cultivated plants of south Asia: millets. Indian J. Genet. Pl. Breed. 11:
CCDB · CromoCat 2015 — Li, H. W., Li, C. H. & Pao, W. K. (1945). Cytological and genetic studies of the interspecific cross of the cultivated foxtail millet, Setaria italica (L.) Beauv., and the green foxtail millet, S. viridis L. J. Amer. Soc. Agron. 37: 32-54.
CCDB · CromoCat 2015 — Li, H. W., Meng, C. J. & Lin, T. N. (1935). Problems in the breeding of millet ( Setaria italica (L.) Beauv.). J. Amer. Soc. Agron. 27: 963-970.
CCDB · CromoCat 2015 — Li, H. W., Pao, W. K. & Li, H. W. (1942). Interspecific crosses in Setaria. VI. Cytological studies of interspecific hybrids involving: 1. S. faberii and S. italica, and 2. a three-way cross, F2 of S. italica x viridis and S. faberii. J. Heredity 33: 351-
CCDB · CromoCat 2015 — Morinaga, T., E. Fukushima, T. Kano, Y. Maruyama & Y. Yamazaki. (1929). Chromosome numbers of cultivated plants. II. Bot. Mag., Tokyo 43: 589-594.
CCDB · CromoCat 2015 — Sharma, A. K. & D. N. De. (1956). Cytology of some of the millets. Caryologia 8: 294-308.
CCDB · CromoCat 2015 — Singh, D. N. & M. B. E. Godward. (1960). Cytological studies in the Gramineae. Heredity 15(2-3): 193-199
CCDB · CromoCat 2015 — Chikara, J. & Gupta, P. K. (1979). Karyological studies in the genus Setaria. I. Variability within Setaria italica (L.) Beauv. Journal of Cytology and Genetics 14: 75-79
CCDB · CromoCat 2015 — Li, M., Song, Y.-c. & Liu, L.-h. (1996). Studies on G-banding karyotypes in millet J. Henan Vocational-Techn. Teaching Coll. 24(1): 1-7
+5 more references
2n 363×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Li, X. l. & R. y. Chen. 1985. The karyotype analysis of Setaria italica and S. viridis. J. Wuhan Bot. Res. 3(4): 409–412.
CCDB · ipcn-api-dl — Guerra, M. d. S. 1986. Citogenetica de Angiospermas coletadas en Pernambuco, I. Revista Brasil. Genét. 9: 21–40.
CCDB · CromoCat 2015 — Li, X.-l. & Chen, R.-y. (1985). The karyotype analysis of Setaria italica and S. viridis Journal of Wuhan Botanical Research 3(4): 409-412
n 912×CCDB · ipcn-api-dl · CCDB · book-ipcn66 · CCDB · book-ipcn67-71 +4
CCDB · ipcn-api-dl — Mehra, P. N. 1982. Cytology of East Indian grasses. ý.
CCDB · ipcn-api-dl — Sinha, R. R. P., A. K. Bhardwaj & R. K. Singh. 1990. SOCGI plant chromosome number reports---IX. J. Cytol. Genet. 25: 140–143.
CCDB · ipcn-api-dl — Tiranti, I. N. & R. N. Genghini. 2000. Caracteres cuantitativos de la microsporogénesis de cuatro especies de Setaria (Poaceae). Bol. Soc. Argent. Bot. 35(3–4): 331–333.
CCDB · book-ipcn66 — Singh & Godward 1960
CCDB · book-ipcn67-71 — GUPTA, P.K . & YASHVIR. 1971. In IOPB chromosome reports XXXII. Taxon 20: 349-356.
CCDB · book-ipcn75-78 — Gupta & Singh 1977
CCDB · book-ipcn75-78 — Christopher & Abraham 1976
CCDB · book-ipcn73-74 — KHOSLA, P.K., & M.L. SHARMA. 1973. Cytological observations on some species of Setaria. Nucleus 16: 38-41.
CCDB · Cave1962 — Willweber-Kish. 1962
CCDB · CromoCat 2015 — Mehra, P. N. (1982). Cytology of East Indian grasses
CCDB · CromoCat 2015 — Sinha, R. R. P., A. K. Bhardwaj & R. K. Singh (1990). SOCGI plant chromosome number reports---IX J. Cytol. Genet. 25: 140-143
CCDB · CromoCat 2015 — Gupta, P. K. & Yashvir (1971). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXXII]. Taxon 20(2/3): 352.
n 181×CCDB · iapt
CCDB · iapt — IAPT/IOPB Chromosome Data 35
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness97.9% BUSCO
07Deep time~3.47 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin3.47 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type9 163 records
Wild obs. + sensor5 156
Museum / vouchered3 279
Cultivated / captive130
Other598
Origin
Native207
Introduced421
Range
Area of Occupancy AOO20 996 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy45% within 1 km
≤100 m 1 261≤1 km 821≤10 km 2 456>10 km 56
4 594 georeferenced · 562 without coordinates
Open the mapobservation + sensor5 156
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy52% within 1 km
≤100 m 315≤1 km 429≤10 km 522>10 km 172
1 438 georeferenced · 1 841 without coordinates
Open the institutions mapphysical evidence3 279
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 14>10 km 34
48 georeferenced · 82 without coordinates
Open the mapnot free-living130
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions162 of 275 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| LDlocation not on record | 253 |
| SLU Artdatabankenlocation not on record | 171 |
| Beijing, CN | 107 |
| Olocation not on record | 93 |
| MeiseBGlocation not on record | 80 |
| Oskarshamn, SE | 78 |
| BRNUlocation not on record | 52 |
| Helsinki, FI | 48 |
| Uppsala, SE | 47 |
| Chongqing Museumlocation not on record | 46 |
| Mount Annan, AU | 45 |
| Wuzhou, CN | 44 |
| International Salmonella Centre (W.H.O.)location not on record | 39 |
| BFLlocation not on record | 38 |
| Bronx, US | 34 |
| DBF-NHMDlocation not on record | 33 |
| Philadelphia, US | 32 |
| Brussel, BE | 32 |
| Adelaide, AU | 31 |
| Bern, CH | 30 |
| Moscow State Universitylocation not on record | 29 |
| Museo Entomologico de Leonlocation not on record | 29 |
| Guilin, CN | 27 |
| Canberra, AU | 27 |
| Brisbane, AU | 27 |
| Taipei, TW | 26 |
| Saint Louis, US | 26 |
| Elocation not on record | 24 |
| KMNlocation not on record | 23 |
| HUN003location not on record | 22 |
| Nijmegen, NL | 22 |
| Pretoria, ZA | 21 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 20 |
| BDBClocation not on record | 19 |
| Burlington, US | 19 |
| Servico de Microbiologia e Imunologialocation not on record | 19 |
| Nanjing, CN | 18 |
| University of New Hampshirelocation not on record | 18 |
| Yangling, CN | 16 |
| South Kensington, GB | 16 |
| Bloomington, US | 16 |
| Kunming, CN | 15 |
| Salzburg, AT | 15 |
| Turku, FI | 15 |
| Adam Mickiewicz University in Poznańlocation not on record | 14 |
| Trondheim, NO | 14 |
| Staten Island, US | 14 |
| New Haven, US | 13 |
| Denver, US | 13 |
| Wuhan, CN | 12 |
| Spearfish, US | 12 |
| Hobart, AU | 11 |
| Lubbock, US | 11 |
| Oulu, FI | 11 |
| Sanda, JP | 11 |
| CICYTEXlocation not on record | 11 |
| Philadelphia, US | 11 |
| Provincia di Livornolocation not on record | 10 |
| Dresden, DE | 10 |
| Guangzhou, CN | 10 |
| St. Paul, US | 10 |
| Allentown, US | 9 |
| Kensington, AU | 9 |
| Frauenfeld, CH | 9 |
| Fort Worth, US | 9 |
| University of Stellenboschlocation not on record | 9 |
| Auckland, NZ | 9 |
| GMBAlocation not on record | 8 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 8 |
| Odawara, JP | 8 |
| Dekalb, US | 7 |
| Logan, US | 7 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 7 |
| Canadian Department of Agriculturelocation not on record | 7 |
| College Park, US | 7 |
| Shinshu Universitylocation not on record | 7 |
| Williamsburg, US | 7 |
| MAlocation not on record | 7 |
| Mlocation not on record | 7 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 7 |
| Riverside, US | 7 |
| Ann Arbor, US | 7 |
| Ciudad Autónoma de Buenos Aires, AR | 6 |
| Shanghai, CN | 6 |
| Barcelona, ES | 6 |
| Chadron, US | 6 |
| Palmerston, AU | 6 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 6 |
| Tartu, EE | 6 |
| Smithfield, AU | 6 |
| BClocation not on record | 6 |
| BAYLUlocation not on record | 5 |
| Kawasaki Shi Tama Ku, JP | 5 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 5 |
| Baroda, IN | 5 |
| Córdoba, AR | 5 |
| Knoxville, US | 5 |
| Davis, US | 5 |
| BSBIlocation not on record | 5 |
| Christchurch, NZ | 5 |
| Xining, CN | 5 |
| Austin, US | 5 |
| Québec, CA | 5 |
| Guangzhou, CN | 5 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 5 |
| Madison, US | 5 |
| Stockholm, SE | 4 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 4 |
| San Isidro, AR | 4 |
| WTUlocation not on record | 4 |
| PrivatHerblocation not on record | 4 |
| Zürich, CH | 4 |
| Corrientes, AR | 4 |
| Tilburg, NL | 4 |
| Kochi, JP | 4 |
| Chengdu, CN | 4 |
| Berlin, DE | 4 |
| Hangzhou, CN | 4 |
| Winterthur, CH | 4 |
| University of Hamburglocation not on record | 4 |
| Urumqi, CN | 4 |
| Vitoria, ES | 4 |
| Nishihara, JP | 4 |
| ESP004location not on record | 4 |
| Natural History Museum Rotterdamlocation not on record | 3 |
| Vancouver, CA | 3 |
| Durban, ZA | 3 |
| Tsukuba, JP | 3 |
| Lanzhou, CN | 3 |
| TAIElocation not on record | 3 |
| Universidad Nacional del Litorallocation not on record | 3 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 3 |
| Montréal, CA | 3 |
| Zürich, CH | 3 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 3 |
| Tampa, US | 3 |
| Tempe, US | 3 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 3 |
| 东北师范大学自然博物馆location not on record | 3 |
| NMBU:MINAlocation not on record | 3 |
| Flagstaff, US | 3 |
| Miami, US | 3 |
| Fairfax, US | 3 |
| Seoul, KR | 3 |
| Kew, GB | 3 |
| Tianjin Natural History Museumlocation not on record | 2 |
| BioFokuslocation not on record | 2 |
| Bozeman, US | 2 |
| IDElocation not on record | 2 |
| Toronto, CA | 2 |
| Bangkok, TH | 2 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 2 |
| Missoula, US | 2 |
| Uniwersytet Opolskilocation not on record | 2 |
| Bergen, NO | 2 |
| QVMAGlocation not on record | 2 |
| Chicago, US | 2 |
| KIRMlocation not on record | 2 |
| Paris, FR | 2 |
| TUR-Alocation not on record | 2 |
| Universidad Nacional de San Luislocation not on record | 2 |
| Castelar, AR | 2 |
| Tokushima, JP | 2 |
| Entomological Society of Latvialocation not on record | 2 |
| US | 2 |
| H-Zimmerlocation not on record | 2 |
| Bando, JP | 2 |
| Zhengzhou, CN | 2 |
| Tallinn, EE | 2 |
| Istituto Agrario Castelnuovolocation not on record | 2 |
| Karlsruhe, DE | 2 |
| València, ES | 2 |
| Green Bay, US | 2 |
| SIHUlocation not on record | 2 |
| Uniwersytet Wrocławskilocation not on record | 2 |
| QAUlocation not on record | 2 |
| Xiamen, CN | 2 |
| Strecker Museum, Baylor Universitylocation not on record | 2 |
| Nagasaki University - Fisherieslocation not on record | 2 |
| Davenport, US | 2 |
| GJOlocation not on record | 2 |
| nlocation not on record | 2 |
| Ural Federal University "B. N. Yeltsin"location not on record | 2 |
| Hazara Universitylocation not on record | 2 |
| Millersville, US | 2 |
| Kyoto Universitylocation not on record | 2 |
| DOI/NPS, Greenbelt Parklocation not on record | 2 |
| UnBlocation not on record | 2 |
| Emporia, US | 2 |
| Chiba, JP | 2 |
| Lausanne, CH | 2 |
| Cape Town, ZA | 2 |
| BISHlocation not on record | 1 |
| Portland, US | 1 |
| Jiangxi College of Educationlocation not on record | 1 |
| Badajoz, ES | 1 |
| BIO-UNIPIlocation not on record | 1 |
| Cape Town, ZA | 1 |
| South China Normal Universitylocation not on record | 1 |
| San Angelo, US | 1 |
| Glarus, CH | 1 |
| Columbia, US | 1 |
| Canadian Museum of Nature, National Herbarium of Canadalocation not on record | 1 |
| Honolulu, US | 1 |
| KR | 1 |
| Gujarat Biodiversity Gene Banklocation not on record | 1 |
| Boise, US | 1 |
| Taipei, TW | 1 |
| Blumenau, BR | 1 |
| Chapel Hill, US | 1 |
| Chengdu, CN | 1 |
| Peking Universitylocation not on record | 1 |
| San Diego, US | 1 |
| Universität Tübingenlocation not on record | 1 |
| Salamanca, ES | 1 |
| Pullman, US | 1 |
| UFSClocation not on record | 1 |
| Texas Lutheran Universitylocation not on record | 1 |
| ASUlocation not on record | 1 |
| Keene State Universitylocation not on record | 1 |
| Provo, US | 1 |
| Uniwersytet Warszawskilocation not on record | 1 |
| James Cook Townsvillelocation not on record | 1 |
| Fukushima Universitylocation not on record | 1 |
| KOMlocation not on record | 1 |
| Norfolk, US | 1 |
| John T. Waterhouse Herbariumlocation not on record | 1 |
| Université Lavallocation not on record | 1 |
| Yaoundé, CM | 1 |
| Kingston, US | 1 |
| Weber State Universitylocation not on record | 1 |
| Durango, MX | 1 |
| H-AkrKGlocation not on record | 1 |
| Philadelphia, US | 1 |
| WNNUlocation not on record | 1 |
| Universität Göttingenlocation not on record | 1 |
| South African National Biodiversity Institutelocation not on record | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| US | 1 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 1 |
| Kushiro City Museumlocation not on record | 1 |
| Universidad Nacional de La Pampalocation not on record | 1 |
| Shanghai, CN | 1 |
| Central China Normal Universitylocation not on record | 1 |
| CZE122location not on record | 1 |
| St. Augustine, TT | 1 |
| Rotorua, NZ | 1 |
| Sendai, JP | 1 |
| Jyväskylä, FI | 1 |
| University of Alberta Museumslocation not on record | 1 |
| Taipei, TW | 1 |
| Oswego, US | 1 |
| GAlocation not on record | 1 |
| CASlocation not on record | 1 |
| Pamplona, ES | 1 |
| Pondicherry, IN | 1 |
| Porrentruy, CH | 1 |
| Nishihara, JP | 1 |
| Coimbra, PT | 1 |
| Uniwersytet Jagiellońskilocation not on record | 1 |
| National Institute of Biological Resourceslocation not on record | 1 |
| Albuquerque, US | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Tuscaloosa, US | 1 |
| Morgantown, US | 1 |
| Wlocation not on record | 1 |
| Bourges, FR | 1 |
| Armidale, AU | 1 |
| EL PASO, US | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| SZUlocation not on record | 1 |
| PRClocation not on record | 1 |
| Tomioka, JP | 1 |
| Kuopio, FI | 1 |
| Pretoria National Herbariumlocation not on record | 1 |
275 institutions · 2 643 of 3 279 vouchered records shown · 627 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA415 detections
Where the DNA of Setaria italica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found415
Studies independent surveys3
Countries7
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 415 detections have coordinates
Open the map7 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Measured at samplingin-field
Temperature18.2 °C 10.4–23.7
pH6.10 4.00–9.40
Conductivity49.0 µS/cm 6.00–126,900
Salinity29.6 PSU 29.6–35.4
Turbidity2.60 NTU 0.279–3.90
Organic carbon0.94 % 0.003–25.3
Water content6.61 % 0–103
Nitrate-N3.91 mg/kg 0.023–59.0
Phosphorus12.0 mg/kg 2.00–483
Clay13.2 % 1.89–70.0
Sand74.8 % 0–98.1
Depth0 m 0–2.00
Coastal waterSoilPelagicSedimentRudosolChromosolsKandosolTenosolsDermosolLatLon out of range
293 samples with on-site data · median with range · describes the sample, not the organism
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median22.2 °C 13.3–27.6
Seasonal swing summer↔winter12.0 °C
Max temp (day)27.6 °C 17.5–33.7
Min temp (night)17.8 °C 9.00–23.5
Precipitation61.3 mm/mo 5.80–170
Air humidity56.4 % 44.1–62.3
Moisture balance-75.7 mm/mo -162–80.5
Vapour deficit1,184 Pa 650–1,832
Wind speed3.00 m/s 1.70–4.70
Cloud cover25.6 % 13.1–51.7
CHELSA 1981–2010, ~9 km grid, at location & month of 402 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.