Sesuvium portulacastrum
(L.) L. · speciesAt a glance
Occurrence records14 195
Data sources16
Biological traits58
DNA specimens21
eDNA detections16
Sources16 archives
Databases and archives Sesuvium portulacastrum's data was compiled from.
WikipediaWikimedia Foundation13 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility14 135 records↗
OBISOcean Biodiversity Information System60 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics21 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
PloiDBPloidy Databasegenome & karyotype
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources58 traits
Chemical compositionLOTUS · NPASS26 compounds
Occurrence & distributionGBIF · OBIS14 195 records
Environmental DNA2 datasets · 5 countries16 detections
DNA & barcodingBOLD · NCBI21 specimens
Genome at a glanceCCDB · GIFT2n = 48
01Narrative
Sesuvium portulacastrum is a sprawling perennial herb that grows in coastal areas throughout much of the world. It is commonly known as shoreline purslane or (ambiguously) "sea purslane," in English, dampalit in Tagalog and 海马齿sl in chinese.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRY
Size & morphology22
Fruit length8 mm
Fruit length max7 mm
Fruit length min4 mm
Fruit width max3 mm
Leaf length23.3 mm
⚠ sources differ — AusTraits: 23.3 mm · GIFT: 32.5 mm
Leaf length max70 mm
Leaf length min10 mm
Leaf width7.5 mm
Leaf width max15 mm
Leaf width min1 mm
Plant height0.2 m
⚠ sources differ — GIFT: 0.2 m · AusTraits: 0.2 m · TRY: 0.75 m
Plant height max0.8 m
Plant height min0 m
Seed length max1.2 mm
Seed mass0.502 mg
⚠ sources differ — TRY: 0.502 mg · AusTraits: 0.451 mg · GIFT: 0.53 mg
Seed mass max0.67 mg
Seed mass min0.391 mg
Seed volume0.46 mm³
Seed volume max0.46 mm³
Seed volume min0.46 mm³
Seed width1.5 mm
Seed width max0.8 mm
Life cycle & reproduction15
Deciduousnessevergreen
Dehiscencedehiscent
Dispersal typewater
Flower colourgreen
Flower length max10 mm
Flower length min4 mm
Flower width max6 mm
Flower width min3 mm
Flowering endSep
Flowering startJun
Flowering timeyyyyyyyyyyyy
Life formsubshrub or shrub
Life spanperennial
Raunkiær life formtherophyte
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment16
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max1 000 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecapsule
Growth formherb
Habitat GIFTÁrea Antrópica, Caatinga (stricto sensu), Campo Limpo, Carrasco, Restinga
Leaf compoundnesssimple
Leaf formelliptic
Leaf shapelanceolate linear oblanceolate
Mycorrhiza type0.000481672
Succulenceno
Woodinessnon-woody
Physiology & chemistry2
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Other traits2
Seeds per fruit11-100
Shoot orientationascending
03Chemical composition26 compounds
Compounds documented for Sesuvium portulacastrum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Aporphine alkaloids $ Isoquinoline alkaloids6
Aporphine alkaloids3
Indole-Diterpenoid alkaloids (Penitrems)3
Dihydroflavonols2
Flavonols1
Documented compounds26 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (12S,13S)-13,16-dimethoxy-11-methyl-3,5-dioxa-11-azapentacyclo[10.7.1.02,6.08,20.014,19]icosa-1(20),2(6),7,14(19),15,17-hexaene | present | NPASS | |
| (12S,13S)-13,16-dimethoxy-3,5-dioxa-11-azapentacyclo[10.7.1.02,6.08,20.014,19]icosa-1(20),2(6),7,14(19),15,17-hexaene | present | NPASS | |
| (12S,13S)-13-methoxy-11-methyl-3,5-dioxa-11-azapentacyclo[10.7.1.02,6.08,20.014,19]icosa-1(20),2(6),7,14(19),15,17-hexaen-16-ol | present | NPASS | |
| (1R,12R,13S,18R)-1,13,17,17-tetramethyl-2-azapentacyclo[10.8.0.02,10.03,8.013,18]icosa-3,5,7,9-tetraen-16-one | present | NPASS | |
| (1R,12S,13S,18R)-1,13,17,17-tetramethyl-2-azapentacyclo[10.8.0.02,10.03,8.013,18]icosa-3,5,7,9-tetraen-16-one | present | NPASS | |
| (1R,2S,10S,12S,13R,16R,18R)-1,13,17,17-tetramethyl-9-azapentacyclo[10.8.0.02,10.03,8.013,18]icosa-3,5,7-trien-16-ol | present | NPASS | |
| (2R,3R)-5-hydroxy-2-(4-hydroxyphenyl)-6,7-dimethoxy-3-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-2,3-dihydrochromen-4-one | present | LOTUS | |
| (2S,3R)-3,5-dihydroxy-2-(4-hydroxyphenyl)-6,7-dimethoxy-2,3-dihydrochromen-4-one | present | LOTUS | |
| (2S,4aS,5R,6R)-5-(1H-indol-2-ylmethyl)-1,1,5,6-tetramethyl-2,3,4,4a,6,7-hexahydronaphthalen-2-ol | present | NPASS | |
| (2S,4aS,5R,6R)-5-(1H-indol-3-ylmethyl)-1,1,5,6-tetramethyl-2,3,4,4a,6,7-hexahydronaphthalen-2-ol | present | NPASS |
05DNA & barcoding21 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sesuvium portulacastrum has left across the world's sequence archives.
At a glance
DNA specimens21
Marker genes6
GenBank sequences10
eDNA detections16
Countries6
The DNA barcodea real sequence read deposited for this species
CAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAACAACCGGCGAACACGTAAACCACTCCTCGGGGC …
Sesuvium portulacastrum isolate leaves small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK2★rbcL7★rbcLa★ITS1★ITS1
animal barcodeplant barcodefungal barcode
06Genome at a glanceCCDB · GIFT
The complete instruction manual Sesuvium portulacastrum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 48 n = 24
Ploidy2× diploid · measured
Chromosome records16–482n range38median48mode12records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 485×CCDB · ipcn-api-dl · CCDB · book-indian_vol1 · CCDB · book-atlas-flowering-plants +1
CCDB · ipcn-api-dl — Satyanarayan, J., P. Sahoo & A. B. Das. 2003. New reports of chromosome number and genome size in eight mangroves from coastal Orissa. Caryologia 56(3): 353–358.
CCDB · book-indian_vol1 — Raghavan, T.S. & Srinivasan, V.K. J940a,e
CCDB · book-atlas-flowering-plants — Raghavlj.n & S. 1940a
GIFT · GIFT (floras)
2n 364×CCDB · book-indian_vol1 · CCDB · Oberlander2016 · CCDB · Cave1956 +1
CCDB · book-indian_vol1 — Sharma, A.K. & Bhattacharyya, N .K. 1956b
CCDB · Oberlander2016 — Carr, 1978;Subramanian, 1988
CCDB · Cave1956 — Sharma& N.K. Bhatt,
GIFT · GIFT (floras)
2n 162×CCDB · book-indian_vol1 · GIFT · GIFT (floras)
CCDB · book-indian_vol1 — Di Fulvio, T.E. 1967
GIFT · GIFT (floras)
2n 401×CCDB · Oberlander2016
CCDB · Oberlander2016 — Carr, 1978;Subramanian, 1988
n 81×CCDB · book-ipcn67-71
CCDB · book-ipcn67-71 — DI FULVIO, T. E. 1967. Recuentos cromosomicos en angiospermas argentinas. Kurtziana 4: 87-90.
n 181×CCDB · Cave1956
CCDB · Cave1956 — Sharma& N.K. Bhatt,
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
polyploid inferred1×PloiDB · family-scale
PloiDB · family-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type14 195 records
Wild obs. + sensor10 387
Museum / vouchered3 462
Cultivated / captive2
Other344
Origin
Native74
Introduced275
Range
Area of Occupancy AOO25 132 km²
Depth
0–200 m sunlit9
200–1000 m twilight0
1–4 km midnight0
>4 km abyssal0
median 0.5 m · max 4 m · 9 records with depth
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy90% within 1 km
≤100 m 5 691≤1 km 1 309≤10 km 424>10 km 328
7 752 georeferenced · 2 635 without coordinates
Open the mapobservation + sensor10 387
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy75% within 1 km
≤100 m 791≤1 km 127≤10 km 275>10 km 30
1 223 georeferenced · 2 239 without coordinates
Open the institutions mapphysical evidence3 462
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 2 records without
Open the mapnot free-living2
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions136 of 260 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Durango, MX | 328 |
| Saint Louis, US | 200 |
| Mexico City, MX | 185 |
| Mérida, MX | 107 |
| Bronx, US | 106 |
| San Diego, US | 87 |
| Canberra, AU | 84 |
| Córdoba, AR | 65 |
| Tampa, US | 60 |
| National Biodiversity Institute, Costa Ricalocation not on record | 58 |
| Museo Entomologico de Leonlocation not on record | 53 |
| Palmerston, AU | 50 |
| University of Stellenboschlocation not on record | 49 |
| Mount Annan, AU | 48 |
| Université de Strasbourglocation not on record | 47 |
| La Paz, MX | 46 |
| Kew, GB | 43 |
| Altos de Pipe, VE | 42 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 40 |
| Tsukuba, JP | 31 |
| Puerto Ayora, EC | 31 |
| Austin, US | 30 |
| Universidade Federal do Maranhãolocation not on record | 26 |
| Xiamen, CN | 25 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 25 |
| BISHlocation not on record | 24 |
| San Isidro, AR | 24 |
| Chicago, US | 23 |
| Honolulu, US | 22 |
| Moscow State Universitylocation not on record | 21 |
| Nishihara, JP | 21 |
| San Francisco de Campeche, MX | 20 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 20 |
| Smithfield, AU | 20 |
| UFBAlocation not on record | 20 |
| Corrientes, AR | 19 |
| Pondicherry, IN | 19 |
| Ciudad de México, MX | 18 |
| Riverside, US | 17 |
| Mérida, MX | 17 |
| US | 17 |
| TAIElocation not on record | 17 |
| University of Papua New Guinealocation not on record | 16 |
| Laboratorio de Ictiologialocation not on record | 15 |
| UFESlocation not on record | 15 |
| St. Augustine, TT | 15 |
| Guangzhou, CN | 14 |
| Aarhus, DK | 14 |
| National Museum of Natural Sciencelocation not on record | 13 |
| LSF/FSA/UAClocation not on record | 13 |
| Adelaide, AU | 12 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 12 |
| Feira de Santana, BR | 12 |
| Federal University of Espírito Santolocation not on record | 12 |
| UFRPElocation not on record | 12 |
| Masindi, UG | 11 |
| UNIVASFlocation not on record | 11 |
| Adam Mickiewicz University in Poznańlocation not on record | 11 |
| Chaguaramas, TT | 11 |
| Göteborg, SE | 10 |
| Auckland, NZ | 10 |
| Taipei, TW | 10 |
| Culiacán, MX | 9 |
| Departamento de Sistematica e Ecologialocation not on record | 9 |
| Chapingo, MX | 9 |
| Paris, FR | 9 |
| Plocation not on record | 9 |
| San José, CR | 9 |
| León, NI | 9 |
| Universidade Federal de Sergipe (UFS)location not on record | 9 |
| JBRJlocation not on record | 8 |
| Miami, US | 8 |
| Universidade Federal do Vale do São Franciscolocation not on record | 8 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 8 |
| Berlin, DE | 8 |
| Fortaleza, BR | 8 |
| IFAN Ch. A. Dioplocation not on record | 8 |
| Stockholm, SE | 8 |
| Herbier National du Gabonlocation not on record | 8 |
| University of Southern Mississippilocation not on record | 7 |
| UFERSAlocation not on record | 7 |
| Tapachula, MX | 7 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 7 |
| Beijing, CN | 7 |
| LBVlocation not on record | 7 |
| HAWlocation not on record | 7 |
| GAlocation not on record | 7 |
| Claremont, US | 7 |
| LDlocation not on record | 7 |
| Chicago, US | 7 |
| ASUlocation not on record | 7 |
| Edinburgh, GB | 6 |
| Mexico City, MX | 6 |
| Universidad de Antioquia (UdeA)location not on record | 6 |
| Nishihara, JP | 6 |
| CJBGlocation not on record | 6 |
| Jackson, US | 6 |
| Jena Microbial Resource Collectionlocation not on record | 6 |
| Wuzhou, CN | 6 |
| Mississippi State, US | 6 |
| Sanda, JP | 6 |
| Chapel Hill, US | 6 |
| IECOSlocation not on record | 6 |
| Bloomington, US | 6 |
| Universidad de Nariño (UdeNar)location not on record | 6 |
| Mazatlán, MX | 5 |
| Ensenada, MX | 5 |
| South Kensington, GB | 5 |
| Bangkok, TH | 5 |
| MeiseBGlocation not on record | 5 |
| UEMAlocation not on record | 5 |
| Chongqing Museumlocation not on record | 5 |
| CPATSAlocation not on record | 5 |
| WAGlocation not on record | 5 |
| Porto Alegre, BR | 5 |
| Guilin, CN | 5 |
| Brisbane, AU | 5 |
| Fort Worth, US | 5 |
| Austin, US | 5 |
| Universidad Nacional de Colombia (UNAL)location not on record | 5 |
| MAlocation not on record | 5 |
| Kensington, AU | 5 |
| James Cook Townsvillelocation not on record | 4 |
| Wellington, NZ | 4 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 4 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 4 |
| UFPElocation not on record | 4 |
| Tuscaloosa, US | 4 |
| Universidade Federal do Espírito Santolocation not on record | 4 |
| Wlocation not on record | 4 |
| Uppsala, SE | 4 |
| HUAlocation not on record | 4 |
| Antiguo Cuscatlán, SV | 4 |
| Provo, US | 4 |
| Appalachian State Universitylocation not on record | 4 |
| Hermosillo, MX | 4 |
| Hobart, AU | 4 |
| Santa Teresa, BR | 3 |
| BMlocation not on record | 3 |
| CEPLAClocation not on record | 3 |
| Christchurch, NZ | 3 |
| Tall Timbers Research Stationlocation not on record | 3 |
| Loja, EC | 3 |
| Zürich, CH | 3 |
| Odawara, JP | 3 |
| Instituto de Investigação Científica Tropicallocation not on record | 3 |
| The University of Arizonalocation not on record | 3 |
| Columbia, US | 3 |
| INMAlocation not on record | 3 |
| Toronto, CA | 3 |
| Guangzhou, CN | 3 |
| Burlington, US | 3 |
| Taipei, TW | 3 |
| Dover, US | 2 |
| Universidade Federal de Santa Catarinalocation not on record | 2 |
| Institut Botanique Ake-Assi d'Andokoilocation not on record | 2 |
| Quito, EC | 2 |
| Herbario Universidad de Concepciónlocation not on record | 2 |
| UERJlocation not on record | 2 |
| UFSClocation not on record | 2 |
| MEXUlocation not on record | 2 |
| Western Carolina Universitylocation not on record | 2 |
| San Luis Potosí, MX | 2 |
| UnBlocation not on record | 2 |
| Ann Arbor, US | 2 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 2 |
| UEPAlocation not on record | 2 |
| Clemson, US | 2 |
| Williamsburg, US | 2 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 2 |
| Tuxtla Gutiérrez, MX | 2 |
| IPA/SPlocation not on record | 2 |
| Arequipa, PE | 2 |
| UFRRJlocation not on record | 2 |
| UTPLlocation not on record | 2 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 2 |
| Armidale, AU | 2 |
| Zapopan, MX | 2 |
| HNBlocation not on record | 2 |
| Arizona State University Biocollectionslocation not on record | 2 |
| Embrapa Amazônia Oriental, Ministry of Agriculturelocation not on record | 2 |
| Cuiabá, BR | 1 |
| Grand Junction, US | 1 |
| Teresina, BR | 1 |
| ARMS-MBONlocation not on record | 1 |
| CNF-UFHBlocation not on record | 1 |
| Philadelphia, US | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 1 |
| Davis, US | 1 |
| Montréal, CA | 1 |
| Puebla, MX | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| Université de Bordeauxlocation not on record | 1 |
| Nanjing, CN | 1 |
| OTSlocation not on record | 1 |
| Salamanca, ES | 1 |
| Universidade da Região de Joinville - Univillelocation not on record | 1 |
| TNMlocation not on record | 1 |
| Olocation not on record | 1 |
| Universidad Tecnológica del Chocó (UTCH)location not on record | 1 |
| John T. Waterhouse Herbariumlocation not on record | 1 |
| Calabar, NG | 1 |
| Little Rock, US | 1 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 1 |
| BGPAlocation not on record | 1 |
| Denver, US | 1 |
| Sendai, JP | 1 |
| Conservatoire Botanique National de Mascarinlocation not on record | 1 |
| Dekalb, US | 1 |
| AUAlocation not on record | 1 |
| La Paz, BO | 1 |
| Montecillo, Texcoco, MX | 1 |
| Institute for Agricultural Research of Mozambiquelocation not on record | 1 |
| Millersville, US | 1 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 1 |
| USONlocation not on record | 1 |
| Salvador, BR | 1 |
| Valdosta State Universitylocation not on record | 1 |
| Eduardo Mondlane Universitylocation not on record | 1 |
| Universidade Federal de Juiz de Foralocation not on record | 1 |
| EL PASO, US | 1 |
| Vancouver, CA | 1 |
| Brasília, BR | 1 |
| Gujarat Biodiversity Gene Banklocation not on record | 1 |
| Museo Jorge Gerholdlocation not on record | 1 |
| Castelar, AR | 1 |
| Cruz das Almas, BR | 1 |
| IBANNlocation not on record | 1 |
| Brookings, US | 1 |
| Due West, US | 1 |
| Shanghai Chenshan Botanical Gardenlocation not on record | 1 |
| Nagano City, JP | 1 |
| Coimbra, PT | 1 |
| Museum of Zoologylocation not on record | 1 |
| Departamento de Geologia, Universidad de Chilelocation not on record | 1 |
| San Francisco, US | 1 |
| Pretoria, ZA | 1 |
| Glocation not on record | 1 |
| INBIOlocation not on record | 1 |
| McWane Science Centerlocation not on record | 1 |
| Kagoshima, JP | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| PRClocation not on record | 1 |
| Museu Paraense Emílio Goeldilocation not on record | 1 |
| Institut de Biologia Evolutiva, (CSIC-UPF)location not on record | 1 |
| Baroda, IN | 1 |
| UFPRlocation not on record | 1 |
| Cochabamba, BO | 1 |
| Phoenix, US | 1 |
| Government College University Lahore, Dr. Sultan Ahmad Herbariumlocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Toyama, JP | 1 |
| MVJBlocation not on record | 1 |
| Northridge, US | 1 |
| Juriquilla, MX | 1 |
| Seychelles National Herbariumlocation not on record | 1 |
| Department of Botany Herbarium Ahmadu Bello University, Zarialocation not on record | 1 |
| Angwin, US | 1 |
| UNIVILLElocation not on record | 1 |
260 institutions · 3 094 of 3 462 vouchered records shown · 313 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA16 detections
Where the DNA of Sesuvium portulacastrum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found16
Studies independent surveys2
Countries5
Verifiable raw sequence linked1
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 16 detections have coordinates
Open the map5 countries0
Coastal AreaLong-Term Ecological Research Site; Marine P…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median25.1 °C 15.7–28.6
Seasonal swing summer↔winter16.5 °C
Max temp (day)30.5 °C 22.0–31.5
Min temp (night)19.3 °C 9.00–25.2
Precipitation79.0 mm/mo 34.7–109
Air humidity52.0 % 50.9–61.5
Moisture balance-93.3 mm/mo -114–-17.8
Vapour deficit1,616 Pa 884–1,804
Wind speed3.00 m/s 1.80–4.10
Cloud cover25.2 % 19.1–34.7
CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.