Sesleria heufleriana

Schur · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Sesleria

At a glance

Occurrence records451

Data sources10

Biological traits17

DNA specimens4

eDNA detections1

Sources10 archives

Databases and archives Sesleria heufleriana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility451 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Occurrence & distributionGBIF451 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB · GoaT4.8 Gbp

01Narrative

{{#ifeq:0|0|{{#if:|{{#if:Sesleriaheufleriana|[}}|}}}} Сеслерія Гойфлера — вид трав'янистих рослин з родини Злакові (Poaceae), поширений в Угорщині, Словаччині, Румунії, Молдові, Україні, Росії.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.5 m

Plant height min0.1 m

Life cycle & reproduction5

Flowering endMay

Flowering startMay

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTmountains, stony places

Woodinessnon-woody

Physiology & chemistry2

Leaf dry-matter content (LDMC)363 mg/g

Specific leaf area (SLA)15.77 mm²/mg

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sesleria heufleriana has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes5

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKP296117.1 ↗604 bpIreland

ACGT

GTGACCCTGACCAAAACAGACCGCGCACGCGTCATCTACCCCGCCGAGCGGCGGCATCGTTCGTCGCTCGGCCAAGTCCTCGACAACCTC …

Sesleria heufleriana voucher LEB<ESP>:M.Muench 3.2010 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL★trnL★ITS1trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB · GoaT

The complete instruction manual Sesleria heufleriana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size4 757 970 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Sesleria heufleriana4.76 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidy4× tetraploid · measured

Chromosome records28–562n range28median28mode9records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 285×GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl · CCDB · kew +1

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · slov-fl — Murín A. & Májovský J., 1976: [Report], pp. 487-488. - In: Löve Á. (ed.), IOPB Chromosome number reports LIII, Taxon 25 /4.

CCDB · kew — Lysák MA, Doležel J. 1998. Estimation of nuclear DNA content in Seslaria (Poaceae). Caryologia 52: 123-132.

CCDB · iapt — IAPT/IOPB Chromosome Data 28

2n 564×GoaT · Kew Plant DNA C-values Database · CCDB · fl-europaea · CCDB · book-fedorov +1

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · fl-europaea — Ujhelyi, 1959

CCDB · book-fedorov — Ujhelyi 1959

CCDB · kew — Lysák MA, Doležel J. 1998. Estimation of nuclear DNA content in Seslaria (Poaceae). Caryologia 52: 123-132.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

tetraploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type451 records

Wild obs. + sensor346

Museum / vouchered55

Other50

Range

Area of Occupancy AOO540 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 46≤1 km 109≤10 km 3

158 georeferenced · 188 without coordinates

Open the mapobservation + sensor346

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy66% within 1 km

≤100 m 4≤1 km 15≤10 km 10

29 georeferenced · 26 without coordinates

Open the institutions mapphysical evidence55

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BRNUlocation not on record	7
Uniwersytet Jagiellońskilocation not on record	4
Denver, US	4
LDlocation not on record	4
Moscow State Universitylocation not on record	3
SLU Artdatabankenlocation not on record	3
Dresden, DE	2
Stockholm, SE	1
Mlocation not on record	1
Salvador, BR	1
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	1
PRClocation not on record	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
BClocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1

15 institutions · 35 of 55 vouchered records shown · 20 without an institution code

09Environmental DNA1 detections

Where the DNA of Sesleria heufleriana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)